ID: 1094502844

View in Genome Browser
Species Human (GRCh38)
Location 12:31036145-31036167
Sequence GAAGATGCACTGCTGCTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094502844_1094502847 -4 Left 1094502844 12:31036145-31036167 CCCAGCAGCAGCAGTGCATCTTC No data
Right 1094502847 12:31036164-31036186 CTTCAGGCAGCTCTGACTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094502844 Original CRISPR GAAGATGCACTGCTGCTGCT GGG (reversed) Intergenic
No off target data available for this crispr