ID: 1094502847

View in Genome Browser
Species Human (GRCh38)
Location 12:31036164-31036186
Sequence CTTCAGGCAGCTCTGACTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094502836_1094502847 26 Left 1094502836 12:31036115-31036137 CCTCCTGGCAGCCACGGCCTCCC No data
Right 1094502847 12:31036164-31036186 CTTCAGGCAGCTCTGACTGCTGG No data
1094502837_1094502847 23 Left 1094502837 12:31036118-31036140 CCTGGCAGCCACGGCCTCCCCAC No data
Right 1094502847 12:31036164-31036186 CTTCAGGCAGCTCTGACTGCTGG No data
1094502845_1094502847 -5 Left 1094502845 12:31036146-31036168 CCAGCAGCAGCAGTGCATCTTCA No data
Right 1094502847 12:31036164-31036186 CTTCAGGCAGCTCTGACTGCTGG No data
1094502839_1094502847 9 Left 1094502839 12:31036132-31036154 CCTCCCCACTGTCCCCAGCAGCA No data
Right 1094502847 12:31036164-31036186 CTTCAGGCAGCTCTGACTGCTGG No data
1094502841_1094502847 5 Left 1094502841 12:31036136-31036158 CCCACTGTCCCCAGCAGCAGCAG No data
Right 1094502847 12:31036164-31036186 CTTCAGGCAGCTCTGACTGCTGG No data
1094502838_1094502847 15 Left 1094502838 12:31036126-31036148 CCACGGCCTCCCCACTGTCCCCA No data
Right 1094502847 12:31036164-31036186 CTTCAGGCAGCTCTGACTGCTGG No data
1094502843_1094502847 -3 Left 1094502843 12:31036144-31036166 CCCCAGCAGCAGCAGTGCATCTT No data
Right 1094502847 12:31036164-31036186 CTTCAGGCAGCTCTGACTGCTGG No data
1094502840_1094502847 6 Left 1094502840 12:31036135-31036157 CCCCACTGTCCCCAGCAGCAGCA No data
Right 1094502847 12:31036164-31036186 CTTCAGGCAGCTCTGACTGCTGG No data
1094502842_1094502847 4 Left 1094502842 12:31036137-31036159 CCACTGTCCCCAGCAGCAGCAGT No data
Right 1094502847 12:31036164-31036186 CTTCAGGCAGCTCTGACTGCTGG No data
1094502844_1094502847 -4 Left 1094502844 12:31036145-31036167 CCCAGCAGCAGCAGTGCATCTTC No data
Right 1094502847 12:31036164-31036186 CTTCAGGCAGCTCTGACTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094502847 Original CRISPR CTTCAGGCAGCTCTGACTGC TGG Intergenic
No off target data available for this crispr