ID: 1094503062

View in Genome Browser
Species Human (GRCh38)
Location 12:31037366-31037388
Sequence CTAAAAACATGTAAGCCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094503062_1094503064 -7 Left 1094503062 12:31037366-31037388 CCTCCAGGCTTACATGTTTTTAG No data
Right 1094503064 12:31037382-31037404 TTTTTAGTTGCTGCAGCATGTGG No data
1094503062_1094503065 6 Left 1094503062 12:31037366-31037388 CCTCCAGGCTTACATGTTTTTAG No data
Right 1094503065 12:31037395-31037417 CAGCATGTGGCCCACAGCAGAGG No data
1094503062_1094503066 9 Left 1094503062 12:31037366-31037388 CCTCCAGGCTTACATGTTTTTAG No data
Right 1094503066 12:31037398-31037420 CATGTGGCCCACAGCAGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094503062 Original CRISPR CTAAAAACATGTAAGCCTGG AGG (reversed) Intergenic
No off target data available for this crispr