ID: 1094503063

View in Genome Browser
Species Human (GRCh38)
Location 12:31037369-31037391
Sequence CAACTAAAAACATGTAAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094503063_1094503064 -10 Left 1094503063 12:31037369-31037391 CCAGGCTTACATGTTTTTAGTTG No data
Right 1094503064 12:31037382-31037404 TTTTTAGTTGCTGCAGCATGTGG No data
1094503063_1094503066 6 Left 1094503063 12:31037369-31037391 CCAGGCTTACATGTTTTTAGTTG No data
Right 1094503066 12:31037398-31037420 CATGTGGCCCACAGCAGAGGTGG No data
1094503063_1094503065 3 Left 1094503063 12:31037369-31037391 CCAGGCTTACATGTTTTTAGTTG No data
Right 1094503065 12:31037395-31037417 CAGCATGTGGCCCACAGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094503063 Original CRISPR CAACTAAAAACATGTAAGCC TGG (reversed) Intergenic
No off target data available for this crispr