ID: 1094503065

View in Genome Browser
Species Human (GRCh38)
Location 12:31037395-31037417
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094503063_1094503065 3 Left 1094503063 12:31037369-31037391 CCAGGCTTACATGTTTTTAGTTG No data
Right 1094503065 12:31037395-31037417 CAGCATGTGGCCCACAGCAGAGG No data
1094503062_1094503065 6 Left 1094503062 12:31037366-31037388 CCTCCAGGCTTACATGTTTTTAG No data
Right 1094503065 12:31037395-31037417 CAGCATGTGGCCCACAGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094503065 Original CRISPR CAGCATGTGGCCCACAGCAG AGG Intergenic
No off target data available for this crispr