ID: 1094503070

View in Genome Browser
Species Human (GRCh38)
Location 12:31037431-31037453
Sequence CACCTTCTCCTGCTCCTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094503067_1094503070 3 Left 1094503067 12:31037405-31037427 CCCACAGCAGAGGTGGCTGAGAT No data
Right 1094503070 12:31037431-31037453 CACCTTCTCCTGCTCCTGCCAGG No data
1094503068_1094503070 2 Left 1094503068 12:31037406-31037428 CCACAGCAGAGGTGGCTGAGATC No data
Right 1094503070 12:31037431-31037453 CACCTTCTCCTGCTCCTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094503070 Original CRISPR CACCTTCTCCTGCTCCTGCC AGG Intergenic
No off target data available for this crispr