ID: 1094505994

View in Genome Browser
Species Human (GRCh38)
Location 12:31061545-31061567
Sequence CCAAGCTGCTGGGTTTTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094505994_1094505998 -4 Left 1094505994 12:31061545-31061567 CCAGTGAAAACCCAGCAGCTTGG No data
Right 1094505998 12:31061564-31061586 TTGGTTGAAACAAGTGTAACAGG No data
1094505994_1094505999 29 Left 1094505994 12:31061545-31061567 CCAGTGAAAACCCAGCAGCTTGG No data
Right 1094505999 12:31061597-31061619 ATATTCAGATATTGATCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094505994 Original CRISPR CCAAGCTGCTGGGTTTTCAC TGG (reversed) Intergenic
No off target data available for this crispr