ID: 1094508535

View in Genome Browser
Species Human (GRCh38)
Location 12:31081900-31081922
Sequence CTCAGCTCACTTTCAAATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 3, 1: 0, 2: 1, 3: 17, 4: 153}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094508531_1094508535 -9 Left 1094508531 12:31081886-31081908 CCCTTAGGAACTTCCTCAGCTCA 0: 3
1: 0
2: 0
3: 9
4: 150
Right 1094508535 12:31081900-31081922 CTCAGCTCACTTTCAAATGGAGG 0: 3
1: 0
2: 1
3: 17
4: 153
1094508530_1094508535 -4 Left 1094508530 12:31081881-31081903 CCATACCCTTAGGAACTTCCTCA 0: 3
1: 0
2: 0
3: 10
4: 144
Right 1094508535 12:31081900-31081922 CTCAGCTCACTTTCAAATGGAGG 0: 3
1: 0
2: 1
3: 17
4: 153
1094508528_1094508535 25 Left 1094508528 12:31081852-31081874 CCACGGTTGTTTTTGAAAGATAA 0: 3
1: 0
2: 1
3: 7
4: 208
Right 1094508535 12:31081900-31081922 CTCAGCTCACTTTCAAATGGAGG 0: 3
1: 0
2: 1
3: 17
4: 153
1094508532_1094508535 -10 Left 1094508532 12:31081887-31081909 CCTTAGGAACTTCCTCAGCTCAC 0: 3
1: 0
2: 1
3: 10
4: 154
Right 1094508535 12:31081900-31081922 CTCAGCTCACTTTCAAATGGAGG 0: 3
1: 0
2: 1
3: 17
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094508535 Original CRISPR CTCAGCTCACTTTCAAATGG AGG Intronic
900083857 1:877399-877421 CTCTGCTCACCTGTAAATGGGGG + Intergenic
901773826 1:11545460-11545482 GTCAGCCCAAGTTCAAATGGTGG + Intergenic
902986296 1:20156363-20156385 CTCATTTCCCTTTCAACTGGGGG - Intergenic
904208989 1:28873454-28873476 CTCAGGCCCCTTTCTAATGGAGG + Intergenic
904655526 1:32043139-32043161 CTGAGCTCACTTTTACATGGTGG - Exonic
904846683 1:33424350-33424372 CTCTGTTCTCTTTCTAATGGGGG - Intronic
908211994 1:61910256-61910278 CTCAGCTCACTAGCAAAGGTTGG - Intronic
911356350 1:96825800-96825822 CTGGGCTCACTTTCCAGTGGAGG + Intergenic
913319396 1:117577789-117577811 CTCAGCTCACCTGCACATGCAGG + Intergenic
913564913 1:120063449-120063471 CTCAGGTAACATTCTAATGGAGG + Intronic
913633217 1:120730114-120730136 CTCAGGTAACATTCTAATGGAGG - Intergenic
914046774 1:144100244-144100266 TTCAGCCCAGTTTCAAAGGGTGG - Intergenic
914131335 1:144860442-144860464 TTCAGCCCAGTTTCAAAGGGTGG + Intergenic
914285499 1:146222799-146222821 CTCAGGTAACATTCTAATGGAGG + Intronic
914546530 1:148673554-148673576 CTCAGGTAACATTCTAATGGAGG + Intronic
914620035 1:149397116-149397138 CTCAGGTAACATTCTAATGGAGG - Intergenic
919521687 1:198597259-198597281 CTCTGTTTACTTTCAAATGTTGG + Intergenic
920679585 1:208062385-208062407 CTCTGCTCACTATCACTTGGTGG - Intronic
920927134 1:210352397-210352419 CTCATCTCACTTTCTAATTCAGG + Intronic
923468838 1:234272454-234272476 CTCAGAACAATTTCAAATGCAGG - Intronic
923942215 1:238840967-238840989 TTCAGCTCAATTTCAAAGGCAGG - Intergenic
1063643932 10:7859610-7859632 CTCACTTCATTCTCAAATGGAGG - Intronic
1064932315 10:20641203-20641225 CTCAGCTCACTCTCAACTTCAGG + Intergenic
1065322731 10:24524269-24524291 CTCATGTCACTTTCTCATGGTGG - Intronic
1068498741 10:57817534-57817556 CTCAGCTCCCTTTCAAAGTTGGG - Intergenic
1068697782 10:59986653-59986675 CTTAGGTCACTTCCAAATCGTGG + Intergenic
1073451145 10:103610117-103610139 CTCAGCTCAGTTTCAACTGGTGG - Intronic
1073698998 10:105903883-105903905 ATATGCTCACTTTCAAATCGTGG + Intergenic
1075645844 10:124095474-124095496 CCCAGATCACTTTCAAATTCAGG + Intergenic
1076323055 10:129598040-129598062 CTCAGAGCACTTCCACATGGTGG - Intronic
1076844419 10:133061990-133062012 TTCAGGTCACTTCCAAATGTTGG + Intergenic
1077165487 11:1133680-1133702 TTCAGCTGACTTTCCACTGGAGG + Intergenic
1080085051 11:28269890-28269912 CTCTGCTTAATTCCAAATGGTGG - Intronic
1082974651 11:59059731-59059753 TCCAGCTCTCTCTCAAATGGGGG + Intergenic
1082979071 11:59103523-59103545 TCCAGCTCTCTCTCAAATGGGGG + Intergenic
1085943515 11:81236718-81236740 CTCTGCTCAATTTCATTTGGAGG + Intergenic
1087229500 11:95644461-95644483 ATCAGCTGACTTTAAAATAGTGG + Intergenic
1087944589 11:104143007-104143029 CACAGCTCACTGAAAAATGGAGG + Intronic
1088558728 11:111090488-111090510 ATCAGCTGACCTTGAAATGGAGG - Intergenic
1090361665 11:126176960-126176982 CTCATCTGAGGTTCAAATGGAGG + Intergenic
1092522873 12:9291730-9291752 CTCAGCTCACTTTCAAATGGAGG + Intergenic
1092544415 12:9440167-9440189 CTCAGCTCACTTTCAAATGGAGG - Intergenic
1094508535 12:31081900-31081922 CTCAGCTCACTTTCAAATGGAGG + Intronic
1098087303 12:66860400-66860422 CTCAACACACTTTCAAAAAGGGG - Intergenic
1099547403 12:84002004-84002026 CTTAGCTTGCTTTCAAATGTTGG + Intergenic
1099961726 12:89403344-89403366 CTCATCACAGTTTCAAATTGAGG - Intergenic
1100532489 12:95473522-95473544 CTCCGCTCACTTTCCAATTCAGG - Intronic
1100876881 12:98971605-98971627 CTCACCTAACATTCAAATGAAGG + Intronic
1103519840 12:121530940-121530962 CTCAGCTCTCTCTACAATGGTGG - Intronic
1103822487 12:123710219-123710241 CTGAGTCCACTTTCAAATAGGGG + Intergenic
1104465068 12:128983642-128983664 CACAGCTCACTTTTCAATGGTGG + Exonic
1104566253 12:129887085-129887107 CTCAGATCTCTTTCAAAAGTAGG - Intronic
1106464903 13:30004752-30004774 CTCAGCTCACTTGCAATTCCAGG + Intergenic
1106487617 13:30186219-30186241 CACAGCTCACTTTCCCATGTTGG + Intergenic
1106572534 13:30940270-30940292 CTCAGCTCAGGTTGAATTGGAGG - Intronic
1107620691 13:42226116-42226138 CTTTGCTCACTTTTTAATGGGGG - Intronic
1108908659 13:55513645-55513667 CTAAGCTCATTTTCACATGTAGG + Intergenic
1109901549 13:68779530-68779552 CTTTGCCCACTTTTAAATGGGGG - Intergenic
1111096814 13:83526618-83526640 TTCTGCTGCCTTTCAAATGGTGG + Intergenic
1112448272 13:99487003-99487025 CTCTGCCCACTCTCACATGGTGG - Intergenic
1113454018 13:110434694-110434716 CTCAGCTCATCTTCAGAAGGTGG + Intronic
1115678966 14:35714835-35714857 CTGACCAAACTTTCAAATGGAGG - Intronic
1115702614 14:35969506-35969528 GTCACGTCACTTGCAAATGGAGG + Intergenic
1121381199 14:93469331-93469353 CTGAGTTCATTTTCAAACGGAGG + Intronic
1121936561 14:98024969-98024991 CTCAGCTCAGTATCAAATGATGG + Intergenic
1123798289 15:23795649-23795671 CTAAGCCCACATTCAAATGAAGG - Intergenic
1124450315 15:29782852-29782874 CTTTGCCCACTTTCTAATGGGGG - Intronic
1125177099 15:36836751-36836773 CTAAGCTCACTTTTAAATGTGGG - Intergenic
1129787474 15:78319347-78319369 CTGGGCTCACTTTCAAAAGCAGG - Intergenic
1131664068 15:94551102-94551124 CAGAGCTCACTCTCTAATGGGGG + Intergenic
1135352120 16:21737979-21738001 AAGAGCTTACTTTCAAATGGAGG + Intronic
1135450610 16:22554102-22554124 AAGAGCTTACTTTCAAATGGAGG + Intergenic
1136227315 16:28867622-28867644 CACAGTTCTCTTTCAAGTGGAGG - Intronic
1148747304 17:49925865-49925887 CTCAGCACACTTTCAAAATGGGG - Intergenic
1153745698 18:8177475-8177497 ATCAGATCACTTTCAAATAAGGG - Intronic
1157387921 18:47275215-47275237 CTCATCTCAGTTTCAAATACGGG - Intergenic
1157600139 18:48888636-48888658 CTCAGCACACGTTCAATTGTGGG - Intergenic
1157699943 18:49755933-49755955 CTGAGCTTACATTCAAATGGAGG - Intergenic
1158791716 18:60787983-60788005 CTCAGGTGACTTTCAACTGATGG + Intergenic
1158835436 18:61326694-61326716 ATCAGCTGACATTCAAATAGGGG - Intergenic
1161855236 19:6760813-6760835 CACAGCCCTCTTTCAACTGGAGG - Exonic
1165520694 19:36311780-36311802 CTCAGCTCACCTTCAGGTGAAGG - Intergenic
1165623377 19:37266804-37266826 CTCAGCTCACCTTCAGGTGAAGG + Intergenic
1167687689 19:50966908-50966930 CTGAACTTACTTTCTAATGGGGG - Intronic
1202686329 1_KI270712v1_random:53658-53680 TTCAGCCCAGTTTCAAAGGGTGG - Intergenic
925109636 2:1322876-1322898 CTGAGCCCTCTTTCAAAAGGTGG - Intronic
925713770 2:6766787-6766809 CTCATTTCACTTTCAACTGCAGG + Intergenic
926497013 2:13603175-13603197 CTCTGCTCAATTTCTCATGGGGG - Intergenic
926499760 2:13639303-13639325 CTCAGTTCACTCTAAAATGTTGG + Intergenic
934245393 2:90301149-90301171 TTCAGCCCAGTTTCAAAGGGTGG + Intergenic
934263352 2:91495880-91495902 TTCAGCCCAGTTTCAAAGGGTGG - Intergenic
936116060 2:109704128-109704150 CTCAGCCCACTTCCAGATGTGGG - Intergenic
938102335 2:128505587-128505609 TCCAGCTCAGTTTGAAATGGTGG + Intergenic
939194005 2:138949945-138949967 ATCAGCTGACTTTTAATTGGGGG - Intergenic
943347686 2:186759209-186759231 CTTAGATCACTTTCAAATCTTGG + Intronic
944893111 2:204137512-204137534 CTCAGATCATTTTCATATTGTGG + Intergenic
946151281 2:217773152-217773174 CTCAGGAAACTTACAAATGGTGG - Intergenic
948085170 2:235241363-235241385 TTCAGTTCACACTCAAATGGCGG + Intergenic
948472889 2:238196593-238196615 CCCAGCTCATTTCTAAATGGAGG - Intronic
948901532 2:240958952-240958974 CTGAGCTCAGTCCCAAATGGAGG + Intronic
1168819638 20:764240-764262 CTCAGTTCCCTCTAAAATGGGGG - Intronic
1169616954 20:7458721-7458743 CTCAGACCACTTTCAGATGTGGG + Intergenic
1169953529 20:11075280-11075302 ATAAGCTCTCTTTCTAATGGAGG - Intergenic
1170901432 20:20466968-20466990 CTCAGCTTTCTGACAAATGGTGG + Intronic
1172667247 20:36608881-36608903 CTCAGCTCACCATCAATTAGGGG - Intronic
1172956224 20:38761352-38761374 GTCACCTAACTTTCAAGTGGTGG - Intronic
1173411207 20:42810765-42810787 ATCAGATCACTTCCACATGGTGG + Intronic
1173537209 20:43824652-43824674 CTCAACTAACTTTCAAATAGAGG + Intergenic
1179294279 21:40046864-40046886 TTGAGCTCACTCTCCAATGGTGG + Intronic
1181850332 22:25745067-25745089 CTCAGCTCTCATTTGAATGGGGG + Intronic
1182399301 22:30062313-30062335 CTCATCTCCCTTTCCCATGGTGG - Intergenic
958088706 3:88847933-88847955 CTATGCCCATTTTCAAATGGTGG + Intergenic
960130596 3:114051727-114051749 CTCAGCTGATTTTGAAAGGGTGG + Intronic
961085723 3:124065954-124065976 CTCAGCTCACTTTCCAGTTTTGG + Intergenic
961769104 3:129235535-129235557 TCCAGCCCACTTTCAAAGGGAGG - Intergenic
962514162 3:136133819-136133841 CTCAGCTCACCATCATATGGTGG - Intronic
963919207 3:150889475-150889497 GTCAGCTGACTTTAAAATAGGGG - Intronic
967231482 3:187341660-187341682 ATCAGCTTTCTTTCTAATGGTGG + Intergenic
968045525 3:195622239-195622261 CCCATCTCATTTTCAGATGGGGG + Intergenic
968064322 3:195750260-195750282 CCCATCTCATTTTCAGATGGGGG + Intronic
972353008 4:38254680-38254702 CTCATCTCACTTTGAAACAGTGG + Intergenic
973219403 4:47708452-47708474 CTCATCTGACCTTCAAATAGGGG - Intronic
974087847 4:57279902-57279924 CTCAGCCCACTTTCACTTGGAGG - Intergenic
974702311 4:65467415-65467437 ATCAGTTCAGATTCAAATGGTGG - Intronic
977231491 4:94455814-94455836 CTCAGCTCACTTTCTGGTGGAGG + Intronic
981687970 4:147476064-147476086 TCCATCTCACTTTCAAAGGGTGG - Intergenic
989140497 5:38196833-38196855 CTGAGATCACTTTCAAATGCTGG - Intergenic
994038849 5:95234225-95234247 CTCAGCCCTCTTTGAAATGTAGG - Intronic
997455387 5:134013638-134013660 CTCTGCCCACTTTTTAATGGGGG - Intergenic
998245694 5:140501890-140501912 CTCACCTCATTTTAAAATAGTGG + Intronic
998453948 5:142255971-142255993 TCCAGCTCACATTCAAAGGGAGG - Intergenic
1002063468 5:176640333-176640355 CCCAGCTCTCCTTCAAAGGGAGG - Intronic
1003614359 6:7641820-7641842 CCCAGCTCACATCCACATGGTGG - Intergenic
1004778713 6:18880531-18880553 CTCATGTGACTTTCAAATGTTGG + Intergenic
1005412449 6:25564807-25564829 CTCAGCTCATTTTCAGACTGAGG + Intronic
1006176907 6:32127995-32128017 CTCCGCTCTCCTTCAGATGGCGG + Intronic
1014265538 6:119272885-119272907 CTCAGTTCACATGGAAATGGAGG - Intronic
1014969599 6:127797906-127797928 TGCAGCTCACTTTAAAATGTGGG + Intronic
1015917930 6:138236936-138236958 CTAAGCCAACTTTCAAATGTAGG + Intronic
1017111562 6:150937477-150937499 CTTAGCTCACTTTACAGTGGTGG + Intronic
1017512997 6:155130559-155130581 CTCATCTCATTTTCAAGTGTGGG + Intronic
1019950400 7:4367621-4367643 CTAAGCTCAAAGTCAAATGGTGG - Intergenic
1021276177 7:18654393-18654415 ATCAGCTCACTTTTATATGGAGG + Intronic
1024865685 7:53903368-53903390 CTCAGGAAACTTTCACATGGTGG + Intergenic
1025477284 7:60939368-60939390 TTCTGCTTTCTTTCAAATGGTGG + Intergenic
1028936972 7:96475813-96475835 TTCTGCTAACTTTCTAATGGTGG - Intergenic
1031908253 7:127485559-127485581 CTCAGGCAACTTTCAAATAGAGG + Intergenic
1032657384 7:133946197-133946219 CTAAGCTGACTTTCATATTGTGG + Intronic
1034311598 7:150093729-150093751 CTCAGCCCCCTTTCAAGGGGAGG + Intergenic
1035550419 8:519390-519412 CTCAGCTGACTCTAAAGTGGGGG - Intronic
1037384374 8:18322021-18322043 CTCAGGAAACTTACAAATGGCGG + Intergenic
1040585440 8:48736188-48736210 CTCATCTCACTTCCAAAAGATGG + Intergenic
1042144550 8:65714434-65714456 ATCAGCTCACTCCCAAGTGGTGG + Intronic
1042170969 8:65990438-65990460 CACAGTTCACTTTCAGATGGAGG - Intergenic
1042740886 8:72044779-72044801 CTCAGCTCACTTACAACTAAAGG + Intronic
1044386836 8:91598984-91599006 CTCAGCTCTCTTTAAAATGAAGG + Intergenic
1045728701 8:105207657-105207679 CTTTGCTCACTTTTTAATGGAGG - Intronic
1045769628 8:105720808-105720830 CTCAGCTCACTTCCACATTTCGG + Intronic
1046536447 8:115518735-115518757 CTCCGATCACTTTAAAATAGAGG + Intronic
1047344641 8:124015229-124015251 CCCAGCCCACCTTCAAAGGGAGG + Intronic
1047906002 8:129473986-129474008 CTCAGCTCAGCTTAACATGGTGG + Intergenic
1050179653 9:2906793-2906815 CTGAGCTCACTTGGAACTGGAGG + Intergenic
1050819267 9:9856830-9856852 CTCAGCTCACTTATCAATAGAGG - Intronic
1051093603 9:13438952-13438974 TTCAGCTTGCTTTTAAATGGTGG + Intergenic
1055281652 9:74681235-74681257 CTGAGCTCCCTTTGAAATGGGGG + Intronic
1056213267 9:84384996-84385018 ATCAGATCACTTTAATATGGGGG - Intergenic
1056503766 9:87236836-87236858 ATAAGCTCTCTTTCAAATGTGGG - Intergenic
1057031872 9:91782160-91782182 CTCAGCTCCCTGTCACAGGGAGG - Intronic
1057359256 9:94358410-94358432 CTCAGCTCACTTTAAAAAGAAGG + Intergenic
1057648508 9:96899180-96899202 CTCAGCTCACTTTAAAAAGAAGG - Intronic
1060023864 9:120154871-120154893 TTCAGCTCACATTCAAGGGGAGG + Intergenic
1060395218 9:123312059-123312081 CTCACCTCACTTCCAGATGTTGG + Intergenic
1188582668 X:31734332-31734354 CTCAGCTCAGTTTCAAAGTCAGG + Intronic
1195732494 X:107981088-107981110 CTCAGATGCCTTTCAACTGGGGG - Exonic