ID: 1094512252

View in Genome Browser
Species Human (GRCh38)
Location 12:31103644-31103666
Sequence CCCTGTCCTGGCCAAGCTGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 396
Summary {0: 3, 1: 1, 2: 4, 3: 33, 4: 355}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094512245_1094512252 -5 Left 1094512245 12:31103626-31103648 CCAGCGATATGCCCGGCCCCCTG 0: 1
1: 2
2: 0
3: 1
4: 87
Right 1094512252 12:31103644-31103666 CCCTGTCCTGGCCAAGCTGCCGG 0: 3
1: 1
2: 4
3: 33
4: 355
1094512242_1094512252 14 Left 1094512242 12:31103607-31103629 CCAGCGTAGTGCTCCTGGACCAG 0: 1
1: 8
2: 0
3: 6
4: 79
Right 1094512252 12:31103644-31103666 CCCTGTCCTGGCCAAGCTGCCGG 0: 3
1: 1
2: 4
3: 33
4: 355
1094512244_1094512252 1 Left 1094512244 12:31103620-31103642 CCTGGACCAGCGATATGCCCGGC 0: 1
1: 2
2: 1
3: 7
4: 43
Right 1094512252 12:31103644-31103666 CCCTGTCCTGGCCAAGCTGCCGG 0: 3
1: 1
2: 4
3: 33
4: 355
1094512240_1094512252 28 Left 1094512240 12:31103593-31103615 CCAGAAGGATTTTGCCAGCGTAG 0: 1
1: 2
2: 0
3: 8
4: 68
Right 1094512252 12:31103644-31103666 CCCTGTCCTGGCCAAGCTGCCGG 0: 3
1: 1
2: 4
3: 33
4: 355

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094512252 Original CRISPR CCCTGTCCTGGCCAAGCTGC CGG Exonic
900000687 1:13288-13310 CCCTGTCCTGGACACGCTGTTGG + Intergenic
900020404 1:183807-183829 CCCTGTCCTGGACATGCTGTTGG + Intergenic
900104062 1:974740-974762 CCCTTCCCTGCCCCAGCTGCTGG - Exonic
900298491 1:1964860-1964882 CCCGTTCCTGGCCCAGCTGCGGG + Intronic
900562200 1:3312652-3312674 CCCGGCCTCGGCCAAGCTGCAGG + Intronic
900656705 1:3762270-3762292 CTCTGTCCTCCCCAGGCTGCTGG + Intronic
901204820 1:7488229-7488251 CCCTGTCCAGGCGCTGCTGCTGG - Intronic
902447628 1:16477019-16477041 CTCAGTCCTGGCCAAGGAGCTGG - Intergenic
902467526 1:16627234-16627256 CTCAGTCCTGGCCAAGGAGCTGG - Intergenic
902507054 1:16945495-16945517 CTCAGTCCTGGCCAAGGAGCTGG + Exonic
902935774 1:19763579-19763601 CCCTGCCCTGGCACAGCAGCAGG - Intronic
903500179 1:23796299-23796321 GCCGGCCCTGGCCCAGCTGCTGG + Intronic
904013916 1:27406074-27406096 CCCTGGCCTGGCCAGGCCCCAGG + Exonic
904559294 1:31385987-31386009 CCCTCACCTGGGCCAGCTGCAGG - Intergenic
905107208 1:35571355-35571377 CTCTGGCCTTCCCAAGCTGCTGG + Intergenic
905109961 1:35587978-35588000 CCCTGGCCTGACCCTGCTGCAGG + Intronic
905741400 1:40374107-40374129 GCCTGTCATGGCCAGGGTGCCGG - Exonic
905914729 1:41676748-41676770 CCCTGCCCTGGCCAGGATGGTGG - Intronic
906117897 1:43367812-43367834 CCCTGCCCTGCCCAGGCTGTGGG - Intronic
907499954 1:54871779-54871801 CCATGTCATGTCGAAGCTGCAGG - Intronic
907524575 1:55046704-55046726 CCCTGGCCTGGCCTCCCTGCTGG + Intronic
910683046 1:89887469-89887491 CCCTGTCCTGGCCATTGTCCTGG + Intronic
910845905 1:91604627-91604649 CCCTGTCCTCCCAAACCTGCAGG + Intergenic
912944868 1:114076479-114076501 CCCTTCCCTGGCCAAAGTGCAGG - Intergenic
913958192 1:143321623-143321645 ACCTGTCCTGGCCCAGCTCTGGG - Intergenic
914052507 1:144146998-144147020 ACCTGTCCTGGCCCAGCTCTGGG - Intergenic
914126690 1:144819543-144819565 ACCTGTCCTGGCCCAGCTCTGGG + Intergenic
914915178 1:151815142-151815164 CCCTGCCTTGGCCAAGTTGTTGG + Exonic
915319086 1:155046344-155046366 CCCTCACCTGGCCAAGGAGCAGG - Exonic
916233528 1:162562454-162562476 CCCTCTCTTGGCCAAGCAGAAGG + Intronic
916519993 1:165555033-165555055 CCCGTGCCTGGCCAAGCGGCTGG - Intronic
917969497 1:180197739-180197761 CCTTGCCCTGGCTTAGCTGCAGG + Exonic
919738646 1:200969573-200969595 TCATGTCCTGCCCAGGCTGCAGG - Intronic
920849307 1:209617915-209617937 CCCTGTCCTGGATAAGCCGAAGG + Exonic
923086306 1:230705872-230705894 CACTGTCCTGCCCAGGCTGGGGG - Intronic
923391273 1:233515817-233515839 CCATGGCCTGGCCCAGCTGTTGG + Intergenic
1062953027 10:1519529-1519551 CTCTCTGCTGGCCCAGCTGCAGG - Intronic
1065333380 10:24627935-24627957 CCCTTTCCTTGCCAAGGTGAAGG - Intronic
1067042479 10:42962398-42962420 CCTTGTCTTGCCCCAGCTGCAGG + Intergenic
1067104665 10:43358129-43358151 CACTGTGTTGGCCAGGCTGCTGG - Intergenic
1067165397 10:43863036-43863058 ACCTGGACTGGCCAAGCTGGTGG - Intergenic
1067183671 10:44009122-44009144 GACTGTCCTGGCCAAGCCACAGG - Intergenic
1067192205 10:44081213-44081235 GCCTGTCCTGGCCACTTTGCTGG - Intergenic
1068520441 10:58071498-58071520 CCCCGTCCAGGCCAAGCCACTGG + Intergenic
1069514689 10:69068304-69068326 CCATGTCCTGACAAAGGTGCTGG - Intergenic
1069801333 10:71083753-71083775 CCCTGTCTTGGGGAAGCTGGAGG + Intergenic
1070543043 10:77430996-77431018 CCCTGGCCTCTCCAGGCTGCAGG + Intronic
1070784992 10:79157690-79157712 CCCTGACCTCACCAAGCTGGGGG - Intronic
1070785066 10:79158002-79158024 CGCTCCCCTGGCCAAGCTGGCGG - Intronic
1071192724 10:83121075-83121097 CTCTGTCATGCCAAAGCTGCTGG - Intergenic
1071416313 10:85444980-85445002 CCCTGTCCAGGCCTGGCTGATGG - Intergenic
1071860885 10:89671399-89671421 CTCTGTCCTCTCCCAGCTGCTGG - Intergenic
1072526138 10:96273116-96273138 CAGTGTCCTGGCCAAGCAGAAGG - Intergenic
1072608907 10:97003937-97003959 CCTGGTGGTGGCCAAGCTGCAGG - Intronic
1072625670 10:97109807-97109829 CTCAGTCCCTGCCAAGCTGCTGG + Intronic
1073496339 10:103894592-103894614 CCCAGTCCAGGAAAAGCTGCTGG - Intronic
1074773296 10:116747415-116747437 CCCTGGCCCTGCAAAGCTGCCGG + Intergenic
1075095939 10:119471061-119471083 CCATTTCCTGGCCATGCTGTTGG + Intergenic
1076850641 10:133090865-133090887 GCCTGGCCCAGCCAAGCTGCTGG - Intronic
1077434789 11:2533762-2533784 CCCTGCCCTGGCCCAGGTGAGGG + Intronic
1077439665 11:2562059-2562081 CCCTGTCCTGGCCTTACTGCTGG - Intronic
1077471261 11:2761765-2761787 CTCTGTCCAGGCCATGCTGTGGG - Intronic
1077581982 11:3422781-3422803 CCCTGTCCTGGCCCCGCCCCAGG - Intergenic
1082122741 11:48397002-48397024 CCCAGTGGTTGCCAAGCTGCTGG - Intergenic
1082251888 11:49991672-49991694 CCCAGTGGTTGCCAAGCTGCTGG + Intergenic
1082556444 11:54568283-54568305 CCCAGTGGTTGCCAAGCTGCTGG - Intergenic
1083443234 11:62690515-62690537 CCCTTTCCTGGCCCAGGTTCAGG - Exonic
1083610208 11:64000733-64000755 CCCTGTCCCGGGCGCGCTGCAGG + Intronic
1083750549 11:64758500-64758522 CCATGTCCAGGCCCAGCTGGAGG + Exonic
1083811415 11:65108788-65108810 CCCTGGCCTGGCCGAGTTGCTGG + Exonic
1083826374 11:65206356-65206378 CCTTGTCCTGGCCAAGGGGCTGG - Intronic
1084238898 11:67805597-67805619 CCCTGTCCTGGCCCCGCCCCAGG - Intergenic
1084400872 11:68942234-68942256 CCCTATCCAGGCCAAACTGTAGG - Intergenic
1084468777 11:69343041-69343063 CCCTGTCCTGTGAAAGCAGCAGG - Intronic
1084833530 11:71787242-71787264 CCCTGTCCTGGCCCCGCCCCAGG + Intergenic
1086015895 11:82167147-82167169 CCCAGTACTGCCCAAGCAGCAGG + Intergenic
1086366629 11:86113648-86113670 CCCTAACCTGGCCAACCAGCTGG + Intergenic
1087693614 11:101350338-101350360 CCATGTCCTAGGAAAGCTGCTGG - Intergenic
1088914608 11:114217964-114217986 CGCTCTCCTGGCCCAGCTCCTGG + Intronic
1089344952 11:117785187-117785209 CCCTGTCCTTTACAAGCTCCTGG - Intronic
1089384791 11:118060494-118060516 CCCTGTCCTGCCCTCGCTGCCGG - Intergenic
1089823193 11:121246750-121246772 CCCTGCTCTGGCTGAGCTGCCGG - Intergenic
1089879937 11:121763828-121763850 ACTTGTCCTGGCCAAGCTAAAGG - Intergenic
1090268576 11:125370339-125370361 CCCTACCCAGGCCAACCTGCAGG + Intronic
1091218125 11:133916041-133916063 CCCTGTCCTGGGTCAGCTGTAGG - Intronic
1091357752 11:134950870-134950892 CCCTACCCTAGCCAAGCTGTAGG - Intergenic
1091373786 12:13415-13437 CCCTGTCCTGGACAGGCTGTTGG + Intergenic
1092396761 12:8134040-8134062 CCTTCTCCAGCCCAAGCTGCTGG + Intronic
1092526480 12:9312942-9312964 CCCTGTCCTGGCCAAGCTGCCGG + Intergenic
1092540796 12:9418840-9418862 CCCTGTCCTGGCCAAGCTGCCGG - Intergenic
1092650617 12:10631174-10631196 ACCTGCCCTGGCTAAGCTGCAGG - Exonic
1092712873 12:11356151-11356173 CCCTATCCTGAGCAGGCTGCGGG - Intronic
1092716669 12:11396127-11396149 CCCTATCCTGAGCAGGCTGCGGG - Intronic
1094512252 12:31103644-31103666 CCCTGTCCTGGCCAAGCTGCCGG + Exonic
1096096816 12:48940893-48940915 CCCTGCCCTGCCTCAGCTGCCGG + Intronic
1096770799 12:53934761-53934783 CCCTTTCCTGTCCAAGGTTCAGG - Intergenic
1096868492 12:54578823-54578845 CCCAGAACTGGCCCAGCTGCAGG + Exonic
1099171161 12:79366443-79366465 CCCTGACCTTGCCAAGAGGCAGG + Intronic
1100804043 12:98262405-98262427 CTCTGGGCTGGCCAAGATGCTGG - Intergenic
1102084243 12:110123211-110123233 CCCTGTACTGTACAGGCTGCTGG - Intergenic
1102441569 12:112967672-112967694 CCCAGCCCTGGCCAAGATCCTGG + Intronic
1102462266 12:113107193-113107215 CCTTGCCTTGGCCCAGCTGCTGG + Exonic
1103528522 12:121583279-121583301 CCCTTTCCTTGGGAAGCTGCAGG - Intergenic
1103773120 12:123344225-123344247 CCCTGACCTGGCTGAGGTGCAGG - Intronic
1104047866 12:125175862-125175884 CCCTGCCCTGGCTCATCTGCTGG + Intergenic
1104711992 12:130993864-130993886 CCCTTTTCTCGCCCAGCTGCAGG + Intronic
1105509251 13:21037751-21037773 CCCAGTGCTGGCCCTGCTGCGGG - Intronic
1105545060 13:21345132-21345154 CCCAGTCCTGGGCTAGCTGCAGG - Intergenic
1110278202 13:73662248-73662270 TCCTGTCCCAGCCAAGCTGGGGG + Intergenic
1110868385 13:80422704-80422726 CCCTTCCCTGGAAAAGCTGCAGG - Intergenic
1113646440 13:111999823-111999845 CCCTGTCCTGTGCCACCTGCAGG - Intergenic
1113767181 13:112888821-112888843 CCCTGTCCTGAGGAGGCTGCCGG + Intergenic
1113849035 13:113407625-113407647 CTCGGTGCTGTCCAAGCTGCGGG - Intergenic
1113928479 13:113953876-113953898 GGCTGTCCTGGACAGGCTGCCGG - Intergenic
1114553815 14:23550232-23550254 GGCTGTCCTGGCCATGCTGAAGG + Intronic
1114566822 14:23639260-23639282 CCGGGCCATGGCCAAGCTGCAGG + Exonic
1115770195 14:36659095-36659117 CCCTGGCCTGAGCCAGCTGCAGG + Intronic
1119034142 14:71215647-71215669 CCCTGTGCTGGCCAAACAGTGGG + Intergenic
1119269757 14:73292293-73292315 TCCTGCCCTGGCCAAAGTGCTGG + Intronic
1120497034 14:85250546-85250568 CCCTGTGCTGTCCCAGGTGCAGG - Intergenic
1120506999 14:85365242-85365264 CCCTGACCTGTCCTACCTGCAGG + Intergenic
1120945030 14:89986662-89986684 CCCTATCCTGGACAAGCCTCTGG - Intronic
1121332122 14:93056210-93056232 CCCACTCCTGGCCAAGCAGAGGG + Intronic
1121655607 14:95593442-95593464 CCCTGTGCTGGGCTGGCTGCTGG + Intergenic
1121929973 14:97963568-97963590 CCCTTTCCTGGCCAAGCCTTGGG - Intronic
1122133627 14:99620335-99620357 CCCTGGCCTCTCCAACCTGCTGG + Intergenic
1122270469 14:100566669-100566691 CCTTGTCGTGGCCAAGGTCCAGG - Intronic
1122311883 14:100802634-100802656 CCCTGTCCTGACCATGGTGATGG + Intergenic
1122832925 14:104411219-104411241 TCCTGCCTTGGCCAAGGTGCTGG + Intergenic
1122853282 14:104548110-104548132 CCCTGTTCTGGCTCACCTGCTGG - Intronic
1122891968 14:104736172-104736194 CACTGTCCTGGCCCCACTGCTGG - Intronic
1123030562 14:105449314-105449336 CCCTGTGCTGACCGTGCTGCCGG + Intronic
1202930205 14_KI270725v1_random:28525-28547 ACCTGTCCTGGCCCAGCTCTGGG + Intergenic
1123422170 15:20142975-20142997 ACCTGTCCTGGCCCAGCTCTGGG - Intergenic
1123442905 15:20303642-20303664 ACCTGTCCTGGCCCAGCTCTGGG + Intergenic
1123531398 15:21149515-21149537 ACCTGTCCTGGCCCAGCTCTGGG - Intergenic
1124268680 15:28260817-28260839 TCCAGTCCTGGCAATGCTGCAGG + Exonic
1124340713 15:28887623-28887645 CCCTCTCCAGCCCAGGCTGCAGG - Intronic
1124597259 15:31101703-31101725 CCCTGCCCTGGCCAAGGAGGAGG - Intronic
1125760840 15:42094486-42094508 CCCAGCCCTTGCCAAGATGCTGG + Exonic
1127295825 15:57607846-57607868 CCATGTCCTGGCCAGGTTCCTGG + Intronic
1129175866 15:73839317-73839339 CCCTGTCCTGGCCACACATCTGG + Intergenic
1129359121 15:75013303-75013325 CACTGTGCTTGCCAAGCAGCAGG + Intronic
1130649894 15:85756540-85756562 CCATGGGCGGGCCAAGCTGCAGG + Intergenic
1131062644 15:89413350-89413372 CCCTTTCCTGGCCAGGGGGCTGG - Intergenic
1132452820 15:101977657-101977679 CCCTGTCCTGGACACGCTGTTGG - Intergenic
1132454078 16:12969-12991 CCCTGTCCTGGACAGGCTGTTGG + Intergenic
1132455993 16:23217-23239 CCCAGTGCAGGCCAAGATGCAGG + Intergenic
1132649647 16:1014669-1014691 CCCTGTCCCAGCCAGGCTGGAGG + Intergenic
1132751091 16:1458071-1458093 CCCTGTGCTGGCCACGCTGGCGG - Intronic
1132754847 16:1478494-1478516 CGCTGTCCTGGAAAAGCTACTGG + Intergenic
1133028497 16:2998756-2998778 CCTTGGCCTGGCCAAGCCACCGG - Intergenic
1133128031 16:3658801-3658823 GCCTGGCCTGGCTCAGCTGCTGG - Exonic
1134415883 16:14043013-14043035 GCCTTTCCTGCCCAAGCTCCGGG - Intergenic
1136378152 16:29877388-29877410 CCGAGTCTTGGCCCAGCTGCGGG - Exonic
1136589666 16:31210243-31210265 GCCAGTCCTGGCCCATCTGCAGG + Intergenic
1137044229 16:35641391-35641413 TCCTGTCCTGGCCAAGCTGCAGG + Intergenic
1137979612 16:53058537-53058559 CCCTGGCCTTGCCAAGCTCTTGG - Intronic
1138528767 16:57623600-57623622 GCCTGGCCTAGCCAAGATGCGGG - Intronic
1138533198 16:57646198-57646220 CGCTGCCCAGGCCAAGCTCCTGG - Intronic
1139561155 16:67743268-67743290 CCCTTTCCTGGCAGAGCTGCTGG + Intronic
1139582690 16:67882740-67882762 GCCTGTGCTAGCCCAGCTGCGGG + Exonic
1139711777 16:68781717-68781739 CCCTGCCTTAGCCAAACTGCTGG + Intronic
1141609132 16:85171249-85171271 CCCTGCCCTCTCCGAGCTGCCGG + Intergenic
1141625895 16:85260921-85260943 ACCTACCCTGGCCTAGCTGCAGG + Intergenic
1141696933 16:85624599-85624621 AGCTGTCCTGGCCATGGTGCCGG - Intronic
1142762962 17:2052059-2052081 GCCCCTCTTGGCCAAGCTGCTGG - Intergenic
1143057219 17:4171370-4171392 CTCTGGCCAGGCCAACCTGCTGG + Intronic
1143103891 17:4519038-4519060 GCCTGGGCTGGCCAAGCTGACGG - Intronic
1144760812 17:17706312-17706334 CCGTGTAGTGGCCAAGCTGGAGG + Intronic
1144782927 17:17816921-17816943 CCCTGCCCTGCCCACTCTGCCGG + Intronic
1145081910 17:19901183-19901205 CCCAGTCCTGCCCAAGCAGAGGG + Intergenic
1145323591 17:21781465-21781487 CCCTGTGCTTGCCAACCTACAGG - Intergenic
1146513855 17:33473720-33473742 CCCTGTTCCTGCCAAGCTCCAGG + Intronic
1146637888 17:34519537-34519559 CCCTGTCCTGGCCTGGATGGGGG - Intergenic
1147647488 17:42042659-42042681 CCTGGTCCTGGGCCAGCTGCAGG - Intronic
1147740807 17:42670130-42670152 CCCGGGCCTGGCCAAGAGGCGGG - Exonic
1147793737 17:43028434-43028456 CACTGTGCTGGCCAAGCAGGTGG + Exonic
1148075375 17:44932620-44932642 CCCCATCCTGGCTGAGCTGCAGG + Intronic
1148808521 17:50276339-50276361 CCCTTTCTGGGCCAACCTGCAGG + Intronic
1149454019 17:56772709-56772731 TCCTGTCTTGGCAAAGCCGCCGG + Intergenic
1150441702 17:65196785-65196807 CCCTCTGCTGGCCAGGCTCCAGG + Intronic
1151724545 17:75876620-75876642 CCCTGACCTGGCCCAGATCCAGG - Intronic
1151727830 17:75894822-75894844 CCCGGTGGTGGCCAGGCTGCGGG + Intronic
1152092201 17:78253168-78253190 GCTTGTCCTGGCCTAGCTGAGGG + Intergenic
1152205234 17:78971142-78971164 CCCTGTCCTTGTGAAGCTACAGG - Intergenic
1152394775 17:80025692-80025714 CACTGCCCTGGGCAAGCTCCTGG - Intronic
1152506329 17:80751341-80751363 GCATGTGCTGGCCCAGCTGCAGG + Intronic
1152520545 17:80853396-80853418 CCCTGACCTGGCCTCGCTGCAGG - Intronic
1152544484 17:80993854-80993876 CCCTGTCCTGGCCGTGTGGCTGG + Intronic
1153871197 18:9321836-9321858 CCCTGCCTTGCCCAACCTGCAGG + Intergenic
1154306512 18:13234426-13234448 CCCTGTCCTGGCCCAGCATCGGG + Intronic
1154497155 18:14970284-14970306 CCCTACCCTAGCCAAGCTGCAGG + Intergenic
1155087398 18:22471669-22471691 CCCTCTCCTGGCCCTGCTTCTGG + Intergenic
1156913408 18:42437830-42437852 TCCTGCCCTGGCCAGGCTCCAGG - Intergenic
1159759587 18:72408161-72408183 CCCTGTCCTGGGAAAGCCACAGG + Intergenic
1160035538 18:75298326-75298348 CCCTTTCCTTGCCCAGCTCCTGG + Intergenic
1160134283 18:76259378-76259400 CCCCCTCCCGCCCAAGCTGCAGG - Intronic
1160373701 18:78395138-78395160 AGATGTCCTGGCCAGGCTGCTGG + Intergenic
1161008339 19:1947696-1947718 CCCTGTCCCAGCCCACCTGCAGG - Intronic
1161659656 19:5538141-5538163 CCCTGTCCTGGCCCAGGTCAGGG - Intergenic
1161793914 19:6375783-6375805 CCCAGCCCTGTCCCAGCTGCAGG + Exonic
1162520938 19:11178952-11178974 CCCTGTCCCTGACTAGCTGCTGG - Intronic
1163441180 19:17323523-17323545 CCGTGTGCTGGCCCAGCGGCTGG - Exonic
1163665930 19:18604127-18604149 TCCTGCCCAGGCCAAGCTGGCGG - Intronic
1163767645 19:19172270-19172292 CCCAGAGCTGGCCCAGCTGCCGG - Intronic
1165096852 19:33414158-33414180 CCCTGCCCTGCCCCACCTGCAGG - Intronic
1165153689 19:33775025-33775047 CCTGGTCCTGGCCAAGGTGCAGG - Intergenic
1166696016 19:44851764-44851786 CCATGTCCTGGCCAAGTTCATGG + Intronic
1166746369 19:45143724-45143746 TCCTGTCCTGCCCATCCTGCAGG + Intronic
1168164232 19:54535722-54535744 CCATCCCCTGGTCAAGCTGCTGG - Exonic
1168649623 19:58085131-58085153 CCCTGTCCGGGGCAGGCTGCTGG + Exonic
1168690525 19:58373929-58373951 CCCAGGACTGGCAAAGCTGCTGG + Intronic
1202653080 1_KI270707v1_random:24257-24279 CCCTTTCCTTGCCAAATTGCAGG + Intergenic
1202691905 1_KI270712v1_random:99422-99444 ACCTGTCCTGGCCCAGCTCTGGG - Intergenic
925279470 2:2672610-2672632 CCGTGTCCAGTCCCAGCTGCAGG - Intergenic
925615498 2:5741013-5741035 GCCAGTCTTGGCCAGGCTGCAGG - Intergenic
926400034 2:12487752-12487774 TCCTCTCCTGGCCATCCTGCAGG + Intergenic
927060305 2:19412453-19412475 CCCTGCCCTCACCAAGCTGGGGG - Intergenic
929441827 2:41971016-41971038 CACTGCCCAGGCCAAGCTGAGGG + Intergenic
929935659 2:46292794-46292816 GCCTGGACTGGCCCAGCTGCCGG - Intergenic
932492965 2:72133199-72133221 CACTGTGCTGGAGAAGCTGCGGG - Exonic
933954488 2:87354534-87354556 ACCTGTCCTGGCCCAGCTCTGGG + Intergenic
934238681 2:90250754-90250776 ACCTGTCCTGGCCCAGCTCTGGG + Intergenic
934274512 2:91565956-91565978 ACCTGTCCTGGCCCAGCTCTGGG - Intergenic
934502750 2:94872607-94872629 CTCAGTCCTGGCCCAGATGCTGG + Intronic
934563954 2:95328165-95328187 CCCAGTCCTGGGGAAGCTGGTGG - Intronic
934886232 2:98027953-98027975 CACTGTCCTTGCCAGCCTGCTGG - Intergenic
936045341 2:109183742-109183764 TCCTGACCTGACCGAGCTGCTGG - Intronic
936047811 2:109200645-109200667 CCCCTACCTGGCCAAGCTGGAGG + Intronic
936569033 2:113600129-113600151 CCCTGTCCTGGACAAGCTGTTGG - Intergenic
937016985 2:118615206-118615228 CCTTGTCAGGGCAAAGCTGCTGG - Intergenic
937071007 2:119063135-119063157 CCCTGTCCTGACCAAGAGACAGG + Intergenic
937253006 2:120535760-120535782 CCCCGTCCTGGTCACACTGCCGG - Intergenic
937974391 2:127573426-127573448 CCCTGGCCTGGACACGCTGTTGG + Intronic
945276378 2:207991562-207991584 CCCAGTTCTGGCCAAGGAGCGGG + Intronic
946324231 2:218975795-218975817 ACCTGTACTGGGCAAGCAGCAGG + Intergenic
946446447 2:219743717-219743739 CTGAGTCCTGGCAAAGCTGCAGG - Intergenic
946608225 2:221429972-221429994 CCCTGTCCTCTTCAAGCTGTTGG + Exonic
947764053 2:232624474-232624496 CCCTGTGTTGGCACAGCTGCTGG - Intronic
947902186 2:233730299-233730321 CCCTGTTCCTGCCAAGCTGAAGG - Intronic
948053549 2:234995429-234995451 CCATGTCATGACCAAGGTGCCGG + Intronic
948423402 2:237874123-237874145 CCCTGTCCGGGTCTGGCTGCAGG - Intronic
948893755 2:240918945-240918967 CCCGGTGCTGGCCAAGGTGACGG + Intronic
1170706288 20:18747373-18747395 CCCCGCCCTGCCCAGGCTGCTGG - Intronic
1171394353 20:24821938-24821960 CCCTGTCCCACCCAAGCTGTGGG - Intergenic
1172029059 20:31968736-31968758 TCCAGACCTGGCCGAGCTGCAGG - Exonic
1172505789 20:35461483-35461505 CCCTGTTTTGGCCCAGCTCCTGG + Intronic
1175972866 20:62695718-62695740 CCCTCTCCTCGCCCAGCCGCAGG - Intergenic
1176131323 20:63497978-63498000 CCCTGGCCAGGCCCAGCTGTGGG - Intronic
1176264189 20:64200142-64200164 CCGTGTCCTTGCCATGATGCTGG - Intronic
1176592218 21:8657107-8657129 ACCTGTCCTGGCCCAGCTCTGGG + Intergenic
1178060499 21:28849007-28849029 CACTGTGCTGCCCCAGCTGCTGG + Intergenic
1178250226 21:30996776-30996798 CCCTCTCCTGGCAAACCTTCTGG + Intergenic
1178323650 21:31625441-31625463 TCCTGTCCTTGCCAAGGTTCTGG - Intergenic
1178408876 21:32347691-32347713 CCCTGTCCTCGTGAAGCTCCTGG - Exonic
1178490642 21:33048928-33048950 CCTTGTCCTAGCAAAGCTGAAGG - Intergenic
1179013456 21:37574455-37574477 CCCTGGCAAGGCCAGGCTGCGGG + Intergenic
1179418174 21:41215030-41215052 CCCTGACCTGTCCAGCCTGCAGG - Intronic
1180275069 22:10634236-10634258 ACCTGTCCTGGCCCAGCTCTGGG + Intergenic
1181014966 22:20063576-20063598 CCCTGTCCAGACGCAGCTGCAGG + Intronic
1181311247 22:21946068-21946090 TCTTGCCCTGGCCTAGCTGCAGG - Exonic
1183384612 22:37507852-37507874 CACTGTCCTGGCCCAACTGGAGG - Exonic
1183675831 22:39298370-39298392 CCCTCTCTTGGCCAAGGTGGAGG - Intergenic
1184177170 22:42794981-42795003 GCCTGTCCAGGCCCAGCCGCAGG + Intergenic
1184345237 22:43909040-43909062 TCTTGTCCTGGCAGAGCTGCTGG - Intergenic
1184644303 22:45888017-45888039 CCCAGTCCTGGCCAAGGCCCGGG + Intergenic
1184685248 22:46093897-46093919 CCCGATGTTGGCCAAGCTGCAGG - Intronic
1184775059 22:46618966-46618988 CCCTGACCTGGCCTCCCTGCAGG - Intronic
1184797109 22:46738700-46738722 GCCTGTCGGGGCCCAGCTGCAGG - Intergenic
1185139488 22:49092372-49092394 CCGTGGCCTGGCCAACCTCCTGG - Intergenic
950120981 3:10482495-10482517 CCCTTTCCTGGCCAGGCTGATGG + Intronic
950429747 3:12943966-12943988 CTCTGTCATGGCCCAGCTCCTGG - Intronic
950503036 3:13376518-13376540 CCTTGGCCTGGCCTGGCTGCTGG - Intronic
950689744 3:14646393-14646415 CCCTGTCCAGGCCTAGCTGCTGG - Intergenic
950905050 3:16530474-16530496 CCCTGTGCTAGGCATGCTGCTGG + Intergenic
951379762 3:21968926-21968948 CTGATTCCTGGCCAAGCTGCTGG + Intronic
953113118 3:39962822-39962844 CCCATTCTTGGCCAAGATGCTGG + Intronic
953159450 3:40404802-40404824 CCCTGTCTTGGCCAAACAGAAGG + Intronic
953350695 3:42213599-42213621 CCCCGCCCGGGCAAAGCTGCAGG - Intronic
954077942 3:48194937-48194959 CCCTGTCCTTCCCAAAGTGCTGG + Intergenic
954331966 3:49895972-49895994 CACCATCCTGGCCAAGCTGCAGG + Exonic
954363578 3:50134820-50134842 CCCTCTGCTTGCCCAGCTGCTGG - Intergenic
954637223 3:52077586-52077608 CCCTGTGCTGGCCAGCCAGCCGG + Intronic
961036655 3:123647186-123647208 CCCTGTGGTGCCCACGCTGCTGG + Intronic
961300006 3:125916317-125916339 CCCTGTCCTGGCCCCGCCCCAGG + Intergenic
961625326 3:128258323-128258345 CCCTGTCCTTCCCACGGTGCTGG - Intronic
961678759 3:128584551-128584573 CCCGGCCCTGGCACAGCTGCAGG - Intergenic
961781632 3:129324063-129324085 CCTTGGCCTGGCCCGGCTGCTGG - Intergenic
962382401 3:134908563-134908585 CCCTGTCCTCACCACGCTGGTGG - Intronic
966680536 3:182637672-182637694 CCCAGTCCTGGCTAACCAGCTGG - Intergenic
967948419 3:194822365-194822387 CCGTGTCCTGGCCCTGCTGCTGG - Intergenic
967964498 3:194950304-194950326 CCCTGTCCAGGACAGGTTGCGGG - Intergenic
968118594 3:196108522-196108544 ACCTGTCCTGCCCAAGCCTCAGG - Intergenic
968464216 4:742374-742396 CCCTGGCCTGGCCGAGCTCATGG + Intronic
968704545 4:2071880-2071902 CCCTGCCCCGGCCAAGTGGCTGG + Intergenic
969134204 4:5016937-5016959 CTGTGTGCTGGACAAGCTGCGGG - Exonic
976223254 4:82775082-82775104 CCCTGTGCTGGCTGAGCTGGAGG - Intronic
980076810 4:128302611-128302633 CCCTGTACAGGCCAAACTGCAGG + Intergenic
982029181 4:151282093-151282115 GCCTGTTCTGACCCAGCTGCAGG + Intronic
984727175 4:183032695-183032717 CCATGACCTGGGGAAGCTGCAGG + Intergenic
984866440 4:184284262-184284284 GGCTGATCTGGCCAAGCTGCTGG - Intergenic
985533201 5:445777-445799 CACAGGCCTGGCCAAGGTGCTGG + Intronic
985706064 5:1401994-1402016 CCTTGGCCTGGCCAGGCTGCTGG + Intronic
985709907 5:1422371-1422393 CCCAGTGCTGCCCAAGGTGCTGG + Intronic
985710003 5:1422743-1422765 CCCAGTGCTGCCCAAGGTGCTGG + Intronic
985710068 5:1423005-1423027 CCCAGTGCTGCCCAAGGTGCTGG + Intronic
986157707 5:5192857-5192879 CCATTTCCTGCCCAAGCAGCTGG + Intronic
986722074 5:10566498-10566520 CCCTGTCCTGGGCAGCCTGGTGG + Intronic
997615961 5:135246401-135246423 CCCTCTCCTGCCACAGCTGCAGG + Intronic
998133829 5:139664361-139664383 CCCTCTCCTGGGCACCCTGCAGG + Intronic
999250194 5:150177962-150177984 CTCTGTCCTGGCAAGGCTGCCGG - Intronic
999445326 5:151634141-151634163 CCCTGCCCTGCCCAGGCTGCTGG + Intergenic
1001034559 5:168288380-168288402 CCCTCTCCTGGCCACCCTCCTGG - Intergenic
1002535985 5:179875831-179875853 CCCTTCCCAGGCCAAGCTCCAGG - Intronic
1002719063 5:181246939-181246961 CCCTGTCCTCGCCCAGCTCCCGG + Intronic
1002923637 6:1592085-1592107 GCCTGGCCTGGCGCAGCTGCAGG - Intergenic
1003406561 6:5831367-5831389 CCCAGTCCTGGGCTGGCTGCAGG + Intergenic
1005972899 6:30775445-30775467 CACTGACCTGGGCAAGCAGCTGG - Intergenic
1006445172 6:34076062-34076084 CCCTGGCCAGGCCCAACTGCTGG - Intronic
1006805995 6:36789591-36789613 CCCTATCAGCGCCAAGCTGCAGG + Intronic
1008081135 6:47195545-47195567 CCCTGCCCTGGGCCAGCTGTTGG - Intergenic
1008618310 6:53247077-53247099 TCCTGCCCTGGCCAAGTTACAGG - Intergenic
1008685908 6:53926011-53926033 CTCTGCCCTGGGCATGCTGCTGG + Intergenic
1011293966 6:85807491-85807513 CACTGTGTTGGCCAGGCTGCTGG + Intergenic
1013808673 6:114020327-114020349 CCCTGACTTGGCCAAGGTGGTGG - Intergenic
1017186518 6:151606149-151606171 ACCTGTGCTGCCCAAGCTGTTGG + Intronic
1018446245 6:163861774-163861796 CCACGTCCTGGCCAAGCAGATGG + Intergenic
1018595174 6:165471569-165471591 CCCTGACCTGTCCATCCTGCAGG + Intronic
1018729857 6:166640553-166640575 CCCTGTTCTGGGCAACCTGCTGG + Intronic
1018872276 6:167792288-167792310 CCCTGTGCTTGACAGGCTGCGGG + Intronic
1018899501 6:168044111-168044133 CCCTCACCTGGGGAAGCTGCAGG - Intronic
1019149064 6:169992560-169992582 TCCTGTCCTGGACGGGCTGCGGG - Intergenic
1019151673 6:170010727-170010749 CACTGCCCTGACCATGCTGCAGG - Intergenic
1019162245 6:170076460-170076482 CCCTGGCCTGGCCTGGCTGGAGG - Intergenic
1019407450 7:891144-891166 CCCTGTCCGAGCCGAGCTGCAGG + Intronic
1019539228 7:1544297-1544319 CCCTGGCCTGGCCCGGGTGCAGG - Exonic
1019577623 7:1745124-1745146 CGCCGGCCTGGCCAAGCTGTCGG + Exonic
1019712459 7:2523899-2523921 CCCTGTCCTGGGTGACCTGCAGG - Intronic
1020960588 7:14797867-14797889 CCCAGAACTTGCCAAGCTGCGGG - Intronic
1023133466 7:37027045-37027067 GTCTGTGCTGGCCCAGCTGCAGG - Intronic
1023684967 7:42724402-42724424 TGCTGTCCTGGCCAGGCTGCAGG + Intergenic
1024046929 7:45591316-45591338 CCCTGATCGGGCCAAGCTACAGG - Intronic
1024282982 7:47734743-47734765 CCCTGTCCTGGCCAGACTGGTGG - Intronic
1024299653 7:47877203-47877225 CCCTGTTCTAACCAGGCTGCAGG + Intronic
1024596787 7:50945353-50945375 CCCTGTTCTGGCCAAGTCTCTGG - Intergenic
1025236646 7:57239272-57239294 CCCTGGCCCGGGGAAGCTGCTGG + Intergenic
1026950169 7:74341559-74341581 CCCTGCCCTGGCCATGGTGAGGG + Intronic
1028480366 7:91297778-91297800 CCGTGTTCTGGCCAGGCTGTAGG + Intergenic
1028533165 7:91861674-91861696 CCCTTTTCTGGACAAGATGCAGG - Intronic
1030333471 7:108298016-108298038 CCCTGTCCTGACTCTGCTGCAGG - Intronic
1031860906 7:126979228-126979250 TTCTCTCCCGGCCAAGCTGCAGG + Intronic
1032083304 7:128870570-128870592 CTCTCTCCTGGCCCAGGTGCGGG + Intronic
1032268808 7:130385792-130385814 ACCTGTCATGGCCAGGCTCCTGG - Intronic
1032488897 7:132309228-132309250 CCATGGTCTGACCAAGCTGCAGG + Intronic
1032683509 7:134209164-134209186 CCTTGTCCTGGCCTGGCTGAGGG - Intronic
1033027842 7:137793554-137793576 GCCTCACCTGGCCAAGGTGCTGG + Intronic
1033220846 7:139525292-139525314 ACCTGCCTTGGCCCAGCTGCTGG - Intronic
1033558528 7:142509490-142509512 GCCTGTCCTGCCCGAGCTCCAGG - Intergenic
1035231809 7:157469953-157469975 CCCTCTCCAGGCCCACCTGCCGG + Intergenic
1036926341 8:12909554-12909576 CCCTGTCCTGCCCAAGGCCCTGG - Intergenic
1037902502 8:22695775-22695797 CGCGGTCCTGGGCGAGCTGCAGG + Intergenic
1039493935 8:37966816-37966838 CCCTGCCGTGGCCAGGCTCCTGG + Exonic
1040105287 8:43538086-43538108 CCCTGTCCAGCCCATCCTGCTGG - Intergenic
1040306465 8:46214515-46214537 CCTTGTCATGGCCAAGATGCAGG + Intergenic
1042773393 8:72403240-72403262 GTCTGTCCTGGTCAAGCTGTTGG - Intergenic
1044306434 8:90645821-90645843 CCCGGGCCTCGCCGAGCTGCCGG - Exonic
1046691817 8:117294293-117294315 TCCTGTCCTGGGCAAAGTGCAGG + Intergenic
1049222869 8:141435856-141435878 CCCAGCCCTGGCCAAGGTGAAGG + Intergenic
1049331401 8:142056036-142056058 CCCTGCCCTGGGCAAACTTCAGG - Intergenic
1049392860 8:142381098-142381120 CCTTGCCCTGGCCCAACTGCTGG + Intronic
1049473803 8:142787781-142787803 CCCTGCCCTGGCTAGGCTGAAGG + Intergenic
1049883496 9:13401-13423 CCCTGTCCTGGACAAGCTGTTGG + Intergenic
1050162592 9:2733892-2733914 CCCTGTTCTGGCCCAGCCGCTGG + Intronic
1051189807 9:14499457-14499479 CCCTGTTCTGGTCAACCTACTGG - Intergenic
1052142478 9:25004154-25004176 CCCTGTCCTGCCACTGCTGCTGG - Intergenic
1052864136 9:33454743-33454765 CCCTGTCTGGGCCAGGCTGTGGG + Intergenic
1057825604 9:98370200-98370222 CCCTGTCCAGGACTAGCTGGAGG + Intronic
1060011081 9:120043314-120043336 CCCTTTCCTGGCCTGTCTGCAGG - Intergenic
1060590072 9:124810947-124810969 CCCTGTTCTGGCTGAGCTGTTGG + Exonic
1061541654 9:131280722-131280744 CACTGACCCTGCCAAGCTGCAGG + Intergenic
1062061016 9:134495011-134495033 CCCTGGCCAGGCCTGGCTGCTGG + Intergenic
1062316997 9:135972192-135972214 CCCTAGCCTGGCCACGCTCCAGG + Intergenic
1062325079 9:136009057-136009079 CCCTGTCCTGGCCAAGGGTGGGG + Exonic
1203790154 EBV:147079-147101 CCCTTTCCTGGCCAACGTGAGGG + Intergenic
1203622271 Un_KI270749v1:135954-135976 ACCTGTCCTGGCCCAGCTCTGGG + Intergenic
1185465525 X:352310-352332 CCCTGTCCTGGCCGTGCGGGTGG - Intronic
1187217181 X:17288551-17288573 GCCTGGCCTGGCCAATCTGAAGG + Intergenic
1190137016 X:47806867-47806889 CCCTGGCCTGGCCAGGCCCCAGG - Intergenic
1190971361 X:55352311-55352333 CCCTGTCCTGGAAGAGCTGTGGG + Intergenic
1191167579 X:57406525-57406547 TCCTGTCCAGGACAAGTTGCTGG - Intronic
1196107490 X:111912317-111912339 CCATGACCTGGCCAAGTTGAAGG - Exonic
1196246337 X:113404264-113404286 CCCTTGCCTGGGAAAGCTGCAGG + Intergenic
1197700479 X:129595882-129595904 CCCTGTGCTGTTCAAGGTGCTGG + Intergenic
1200400376 X:156016508-156016530 CCCAGTTCAGGCCAAGATGCAGG - Intergenic
1200402320 X:156026748-156026770 CCCTGTCCTGGACAAGCTGTTGG - Intergenic