ID: 1094515867

View in Genome Browser
Species Human (GRCh38)
Location 12:31125661-31125683
Sequence AATTCAGCACAAACAGAGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094515867_1094515874 30 Left 1094515867 12:31125661-31125683 CCGACCTCTGTTTGTGCTGAATT No data
Right 1094515874 12:31125714-31125736 ACACCAAGTACCTCAAAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094515867 Original CRISPR AATTCAGCACAAACAGAGGT CGG (reversed) Intergenic
No off target data available for this crispr