ID: 1094517545

View in Genome Browser
Species Human (GRCh38)
Location 12:31147439-31147461
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1104
Summary {0: 8, 1: 32, 2: 102, 3: 250, 4: 712}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094517545_1094517560 20 Left 1094517545 12:31147439-31147461 CCCCACCCCATCTGTGGAAAAAT 0: 8
1: 32
2: 102
3: 250
4: 712
Right 1094517560 12:31147482-31147504 CCTGGTGCCACAAAGGTTGGGGG No data
1094517545_1094517553 13 Left 1094517545 12:31147439-31147461 CCCCACCCCATCTGTGGAAAAAT 0: 8
1: 32
2: 102
3: 250
4: 712
Right 1094517553 12:31147475-31147497 GCCAGTCCCTGGTGCCACAAAGG No data
1094517545_1094517555 17 Left 1094517545 12:31147439-31147461 CCCCACCCCATCTGTGGAAAAAT 0: 8
1: 32
2: 102
3: 250
4: 712
Right 1094517555 12:31147479-31147501 GTCCCTGGTGCCACAAAGGTTGG 0: 27
1: 1001
2: 1722
3: 1434
4: 986
1094517545_1094517558 19 Left 1094517545 12:31147439-31147461 CCCCACCCCATCTGTGGAAAAAT 0: 8
1: 32
2: 102
3: 250
4: 712
Right 1094517558 12:31147481-31147503 CCCTGGTGCCACAAAGGTTGGGG 0: 30
1: 1025
2: 1597
3: 1328
4: 940
1094517545_1094517551 2 Left 1094517545 12:31147439-31147461 CCCCACCCCATCTGTGGAAAAAT 0: 8
1: 32
2: 102
3: 250
4: 712
Right 1094517551 12:31147464-31147486 TCTTCCATGAAGCCAGTCCCTGG 0: 12
1: 344
2: 582
3: 1218
4: 1421
1094517545_1094517556 18 Left 1094517545 12:31147439-31147461 CCCCACCCCATCTGTGGAAAAAT 0: 8
1: 32
2: 102
3: 250
4: 712
Right 1094517556 12:31147480-31147502 TCCCTGGTGCCACAAAGGTTGGG 0: 27
1: 1033
2: 1643
3: 1391
4: 994

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094517545 Original CRISPR ATTTTTCCACAGATGGGGTG GGG (reversed) Intergenic
900071899 1:778018-778040 TTTTTTCTAGAGATGGGGTCGGG - Intergenic
901287365 1:8091549-8091571 TTTTTTGCAGAGATGGGGTTTGG + Intergenic
901304535 1:8223161-8223183 ATTTTTCCACAGCCGGGGGCTGG - Intergenic
901516792 1:9753081-9753103 ATTTCTCCACAGATGGGGGTGGG + Intronic
901578983 1:10224890-10224912 GTTTTTCCACAGACAGGGTTGGG + Intronic
901702713 1:11054062-11054084 ATTTGTCCACATAGGGGGCGGGG + Intergenic
901714232 1:11140295-11140317 ATTATTCCACAGATTGGGTGGGG + Intronic
901895285 1:12306748-12306770 ATTTTTCCACAGACAGGGTTGGG + Intronic
902592736 1:17486637-17486659 ATTTTTCCACAGACTGAGTCGGG - Intergenic
902600078 1:17534967-17534989 ATTTTTCCATGGATGGGGTGGGG + Intergenic
903701935 1:25255558-25255580 ATTTTTCCACAGCTGGGGGTGGG + Intronic
903893780 1:26588748-26588770 ATTTTAGTACAGATGGGGTTTGG + Intergenic
904246126 1:29189378-29189400 ATTTTTGTAGAGATGGGTTGGGG + Intergenic
904353053 1:29921373-29921395 ATTTTTCCACAGACGGGGGTGGG + Intergenic
904410915 1:30324419-30324441 GTGTTTCCACTGATGGGCTGTGG + Intergenic
905027045 1:34857793-34857815 ATTTTTCCACAGATGGGGGTTGG + Intronic
905246898 1:36621217-36621239 ATTTTCCCACAGATAGGTCGGGG + Intergenic
905765427 1:40596234-40596256 ATTTTTCCACGGATGGCAGGAGG - Intergenic
905998259 1:42401034-42401056 ATTTTTCCACAGATGGGGGTGGG + Intronic
906440242 1:45836877-45836899 GTTTTTCCACAGATGGGTGGAGG + Intronic
907481140 1:54746327-54746349 ATTTTTCCACAGGATGGGGGAGG - Intergenic
907504044 1:54904215-54904237 TTTTTTGTACAGATGGGGTCAGG + Intergenic
907597708 1:55734954-55734976 ATTTTTACAAAGATGGAGAGAGG - Intergenic
907911215 1:58828328-58828350 ATTTTTCCATAGATGGGGCAGGG - Intergenic
907916559 1:58875105-58875127 AGTTGTCCACAAAGGGGGTGGGG + Intergenic
908015882 1:59835701-59835723 ATTTTTCCACAGACCCGGGGTGG + Intronic
908292948 1:62686947-62686969 TTTTTTGCAGAGATGGGGTGGGG + Intronic
908405937 1:63814415-63814437 GTTCTTCCACCGATGGGGTGGGG + Intronic
908588718 1:65604880-65604902 ATTTTTCCACTAATGGGGGATGG - Intronic
909170969 1:72294928-72294950 ATCTTTCCAGGGATGGGGTGGGG + Intergenic
909423901 1:75499219-75499241 ATTTTTCCATGGATGGGGGCCGG + Intronic
909447828 1:75767185-75767207 ATTTTTCCACAGACACAGTGGGG - Intronic
909533000 1:76701765-76701787 ATTTTTCCATGGATGGGGGCAGG + Intergenic
909711171 1:78651132-78651154 ATTTTTCCACAGACTGGTGGTGG + Intronic
910411934 1:86955456-86955478 ATTTTTCCACAGGGGGTGGGCGG - Intronic
910621481 1:89260073-89260095 ATTTTTCCACAGAGGGTTGGCGG + Intronic
910687269 1:89930078-89930100 ATTTTTCCAGAAATGGGGGTTGG - Intronic
910824965 1:91397073-91397095 GTTTTTCCACAGATGGTTTCGGG - Intronic
910977143 1:92918757-92918779 GTTTTGCAACAGATGGGGTGGGG + Intronic
911363049 1:96903096-96903118 AGTTTTCCACAGATGGACAGTGG + Intergenic
911695116 1:100882100-100882122 ATTTTTCCATGGATGGGTGGTGG - Intronic
911719730 1:101177819-101177841 ATTTTTCCACAGAGTGGGTTGGG - Intergenic
911894062 1:103406721-103406743 ATTTTTTCATGGACGGGGTGGGG - Intergenic
911985731 1:104619621-104619643 ACTTTTCACCAGATGTGGTGTGG + Intergenic
912020417 1:105102574-105102596 ATTGTTGCAAAAATGGGGTGGGG - Intergenic
912540243 1:110409399-110409421 AATGATCCACAGAGGGGGTGAGG - Intergenic
912880341 1:113406114-113406136 ATTTTTTTAAAGATGGGGTTTGG - Intronic
913173556 1:116253959-116253981 ATTTTTCCATGGATGGGGCAAGG - Intergenic
913390113 1:118301147-118301169 ATTTTTACAGTGATAGGGTGAGG + Intergenic
913657087 1:120971622-120971644 ATTTTTCCACAGACAAGGTGGGG + Intergenic
914008431 1:143754705-143754727 ATTTTTCCACAGACAAGGTGGGG + Intergenic
914319902 1:146549113-146549135 ATTTTTCCACAGATTGGGGGTGG - Intergenic
914335830 1:146714389-146714411 ATTTTTCCATGGACTGGGTGGGG - Intergenic
914521650 1:148422876-148422898 ATTTTTCCACAGACAAGGTGGGG + Intergenic
914647061 1:149663357-149663379 ATTTTTCCACAGACAAGGTGGGG + Intergenic
914841540 1:151253156-151253178 TTTTTTTCAGAGATGGGGTCTGG + Intergenic
915395840 1:155583360-155583382 ATTTTTATAGAGATGGGGTCTGG - Intergenic
915411445 1:155703968-155703990 ATTTTTACAGAGATGGGGTCTGG - Intronic
915962077 1:160275283-160275305 AGTTTTCCACAGAGGGGGGTGGG - Intergenic
916236495 1:162594053-162594075 ATTTTTCCACAGACTTGGGGTGG + Intronic
916619211 1:166477563-166477585 ATTTTTCCACAGAGTGGGGTGGG + Intergenic
916874770 1:168957664-168957686 ACTTTTCCACAGATGGGCTCAGG + Intergenic
916929800 1:169564710-169564732 GATTTTCCACAGTTGGGATGGGG - Intronic
917031871 1:170701987-170702009 ATTTTTCCATGGATGGGGGAAGG + Intronic
917203447 1:172542650-172542672 ACTTTGCCATGGATGGGGTGGGG - Intronic
917624302 1:176830189-176830211 ATTTTTTAAGAGATGGGGTCTGG - Intronic
917860647 1:179139910-179139932 ATTTTTTCACAGACTGGGTGGGG - Intronic
918460141 1:184767995-184768017 TTTTTTCCACGGATGGGGCAGGG - Intergenic
918733342 1:188026640-188026662 ATTTTCTCACAGATAGGGTTTGG - Intergenic
919615278 1:199799501-199799523 ATTTTTCTACAGATAGGGGTTGG - Intergenic
919962031 1:202480955-202480977 ATTTTTCCACAGACTGGTGGGGG + Intronic
919996567 1:202757052-202757074 ATTTTTCCATGGATGGGGAAGGG + Intronic
920580127 1:207098580-207098602 ACTTTTCCACGGATGGGGGTGGG + Intronic
921151863 1:212409139-212409161 ATTTTTCCACAGATGGAGGTTGG - Intronic
921361223 1:214332664-214332686 TTTTTTCCAAACCTGGGGTGGGG - Intronic
921566809 1:216731348-216731370 ATTTTTCCTCTTATGGGGAGAGG + Intronic
921589905 1:216991192-216991214 ATTTTTCCATGGATGGGTGGGGG - Intronic
921850130 1:219925831-219925853 TTTTTACTAGAGATGGGGTGGGG + Intronic
922254422 1:223880588-223880610 ATTTTTCCACAGATGCAGGCGGG + Intergenic
922266834 1:223991975-223991997 TTTTTTCTAGAGATGGGGTCGGG - Intergenic
922293257 1:224226818-224226840 ATTTTTCCACAGACAGGGTCAGG + Intergenic
922607852 1:226902095-226902117 GTTTTTCCACAGATAGGGGTTGG + Intronic
922656895 1:227392956-227392978 GTTTTTGGAGAGATGGGGTGGGG - Intergenic
922781417 1:228256049-228256071 ATTTTTCCACAGATGGGGGTTGG - Intronic
923512556 1:234665002-234665024 ATTTTTCCACGGTTGGGGGGTGG - Intergenic
923616745 1:235544655-235544677 TTTTTTCCACAGATGTGGGGTGG - Intergenic
924349462 1:243101138-243101160 TTTTTTCTAGAGATGGGGTGGGG - Intergenic
924893391 1:248308816-248308838 ATTTTTCCACTGATTGGGCAGGG - Intergenic
924895365 1:248332843-248332865 ATTTTTCCACTGATGTGGCAGGG - Intergenic
1063499457 10:6539681-6539703 ATTTTTCCACAGACTGGGGTGGG - Intronic
1063594420 10:7420901-7420923 ATTTTTCCATGGATGGGCAGTGG - Intergenic
1063617756 10:7616475-7616497 ATTGTTCCAGAGACAGGGTGGGG - Intronic
1063784274 10:9362873-9362895 ATTTCTCCACGGATGGGGGCGGG - Intergenic
1063915015 10:10872734-10872756 TTTTTTGCACCCATGGGGTGAGG + Intergenic
1064269492 10:13852111-13852133 ATTTTTCCACAGATGGGGTGTGG - Intronic
1064310394 10:14207288-14207310 ATTTTTCCACGGATGGGGGTGGG + Intronic
1064646382 10:17464350-17464372 TTTTTTCCACAGATGGAGTGGGG - Intergenic
1064679647 10:17797036-17797058 ATTTTTCCACAGCCAGGGTTGGG - Exonic
1064744021 10:18461547-18461569 ATTTTTCCACAGGTGGGGAGGGG + Intronic
1065009923 10:21411704-21411726 ATTTTTCCACAGATGCGGGGTGG + Intergenic
1065505847 10:26429472-26429494 ATTTTTCCACAGATTGGTGGGGG - Intergenic
1065660721 10:28001876-28001898 ATTTTTCCATGGATAGGGTGTGG - Intergenic
1065936334 10:30523582-30523604 ATATTTACACAGATGGTTTGGGG - Intergenic
1065939562 10:30551758-30551780 ATTTTTCCACAGACTGGGGTGGG + Intergenic
1065960241 10:30728003-30728025 ATTTTTCCATGGATGGGGAGAGG + Intergenic
1066022601 10:31318966-31318988 AGTTTTCCTCAGGTGTGGTGGGG - Intronic
1066199465 10:33131279-33131301 ATTTTTCCACAGAGAGGGACAGG + Intergenic
1066242076 10:33547770-33547792 ATTTTTCCATGGATCAGGTGAGG + Intergenic
1066285155 10:33958702-33958724 ATTTTTCCATGGATGGGGTAGGG + Intergenic
1066397515 10:35040712-35040734 ATTTTTCCACAGACGGAGTGCGG + Intronic
1066643832 10:37584865-37584887 ATTCTTGCACAGTTTGGGTGTGG - Intergenic
1067844949 10:49712295-49712317 TTTTCTCCATAGATGGGGGGAGG - Intergenic
1068177425 10:53478917-53478939 ATTTTTCCTCAGGCTGGGTGTGG - Intergenic
1068194129 10:53694379-53694401 TTTTTTCCACAGACGGGGGTAGG + Intergenic
1068505150 10:57891082-57891104 TTTTTTCCACAGATGGTGGTGGG - Intergenic
1068874668 10:61983590-61983612 TTTTTTCCTCAGGTGGGATGTGG - Intronic
1068959220 10:62849879-62849901 ATTTTTCCACAGATGGGGGCTGG - Intronic
1069280176 10:66645820-66645842 ATTTTTCCACGGATAGTGAGTGG - Intronic
1069321129 10:67172961-67172983 TTTTTTCCTGAGATGGGGTCTGG - Intronic
1069357268 10:67601263-67601285 ATTTTTCCACAGATGGTGGATGG + Intronic
1069605067 10:69733700-69733722 ATTTTTCCATAGACGGGGTGGGG - Intergenic
1070025412 10:72627033-72627055 CTATTTCCACAGCAGGGGTGAGG - Intergenic
1070402817 10:76068405-76068427 ATTATTCCACAGACTGGGGGTGG + Intronic
1070795242 10:79212478-79212500 TTTTTTGCACAGATGGGGCTGGG + Intronic
1071323992 10:84493718-84493740 ACTTTTCCACAGATGGGGAGAGG + Intronic
1071357881 10:84816739-84816761 ATTTTTCCATAGATGGGGGTTGG + Intergenic
1071953898 10:90735836-90735858 ATTTTTGTAGAGATGGGGGGTGG - Intergenic
1072056050 10:91756957-91756979 ATTTTTCCACAGATGGGGATGGG + Intergenic
1072256883 10:93629610-93629632 ATTTTTCCACAGAATGAGGGTGG + Intronic
1072332696 10:94369233-94369255 ATTTTTCCACAGATCAGGGTGGG + Intergenic
1072424536 10:95318799-95318821 ATTTTTCCACAGATGGGGTGGGG + Intronic
1073505613 10:103986138-103986160 ACTTTTCCACAGACTGGATGCGG + Intronic
1073682498 10:105719421-105719443 ATTTTTCCACAGATGGAGGTGGG + Intergenic
1074124556 10:110517684-110517706 ATTTTCCCACAGACGGGGTTCGG - Intergenic
1074382121 10:112989893-112989915 ATTTTCTAATAGATGGGGTGAGG + Intronic
1074663435 10:115690266-115690288 ATTTTTCTACAGATGGGGGTGGG + Intronic
1074928279 10:118096005-118096027 AATTTTCCAGATATGGGGTCAGG - Intergenic
1075290149 10:121222361-121222383 ATTTTTCCACGGATGTGGAGTGG - Intergenic
1075682848 10:124344609-124344631 ATTTTTCCATGGACAGGGTGTGG + Intergenic
1075740983 10:124696484-124696506 ATTTTTCCACATAAGTGATGTGG + Intronic
1076201312 10:128560848-128560870 ATTTTTCCCCAGATGGCGGAGGG + Intergenic
1076314218 10:129529316-129529338 ACTTTTCCACAGATGGGAGTGGG + Intronic
1076621232 10:131789448-131789470 ATTTCTCCACAGACTGGGGGTGG - Intergenic
1077242700 11:1519077-1519099 ATGGTTCCCCAGGTGGGGTGTGG - Intergenic
1077505141 11:2926587-2926609 ATTTTTCCACGGATGTGGGTGGG + Intergenic
1077860846 11:6178480-6178502 ATTTTTCCACAGACAGGGGAAGG - Intergenic
1078056544 11:8013942-8013964 TTTGTTCCTAAGATGGGGTGGGG - Intergenic
1078099629 11:8322319-8322341 GTTTTTCCACAGATCGGGTAGGG - Intergenic
1078229790 11:9429972-9429994 ATTTTTCCACAGATGGTCCGGGG + Intronic
1078352140 11:10603353-10603375 ATTTTTCCACAAACCTGGTGGGG + Intronic
1078396625 11:10987399-10987421 ATTTTTCCACAGATGGGAGGGGG - Intergenic
1078681368 11:13479824-13479846 ATTGTTTCACAGATGGTGTTTGG + Intergenic
1078812690 11:14784127-14784149 ATTTTTCCACAGACTGGGTAGGG - Intronic
1080242876 11:30147241-30147263 ATTTTTCCACAGATGGGGGTGGG + Intergenic
1080293478 11:30698304-30698326 GTTTTTCCATGAATGGGGTGGGG + Intergenic
1080454513 11:32406207-32406229 ATTTTTCCACAGACCAGGGGTGG + Intronic
1080470231 11:32538353-32538375 ATTTTTCCATGGATGGGGGTCGG + Intergenic
1080492596 11:32782303-32782325 ATTTTTCCACAGACTGGGGCTGG - Intronic
1080722785 11:34866261-34866283 ATTTTCCCACAGATGGGGTGAGG - Intronic
1080723651 11:34873285-34873307 ATTTTTCCACAGATGGGGGCAGG - Intronic
1080937848 11:36882376-36882398 ATGTGCCCACAGATGTGGTGTGG + Intergenic
1081215874 11:40397168-40397190 ATGTTTCCAGAGATTGGGTAGGG - Intronic
1081281182 11:41210840-41210862 ATTCTTCCACTGATGGGGGTTGG + Intronic
1081552564 11:44127554-44127576 ATTTTTCCACAGACTGGGTTTGG - Intronic
1081701823 11:45157219-45157241 ATTTTTCCATGGACGGGGTCGGG + Intronic
1082072071 11:47947225-47947247 ATTCATCCACCGATGGTGTGCGG - Intergenic
1082708842 11:56527915-56527937 ATTTTTCCATGGATGGGGGTTGG + Intergenic
1082801485 11:57418154-57418176 AATTTTCTAGAGAAGGGGTGAGG - Intronic
1082841384 11:57692950-57692972 CTTTTTCCACAGATGGGGGCTGG + Intronic
1083576675 11:63796899-63796921 ATTTTTCCACAGACAGGGTTGGG + Intergenic
1083959885 11:66008763-66008785 GGTTTTCCACAGCTGGGCTGAGG + Intergenic
1084006439 11:66325930-66325952 AAGGTTCCAGAGATGGGGTGGGG - Intergenic
1084932356 11:72567112-72567134 ATTTTTCCACGGACGAGGAGTGG + Intergenic
1085017971 11:73187813-73187835 TTTTTTGTAGAGATGGGGTGGGG + Intergenic
1085591304 11:77763896-77763918 ATTTGTCCACAGACTGGGGGTGG + Intronic
1085885608 11:80518287-80518309 ATTTTTCCACATACTGGGGGTGG - Intergenic
1086037717 11:82436890-82436912 GTTTTTACATGGATGGGGTGTGG - Intergenic
1086293537 11:85338677-85338699 ATTTATACACAGAGGGTGTGTGG - Intronic
1086457277 11:86971798-86971820 TTTTTTGTGCAGATGGGGTGGGG + Intergenic
1086793294 11:91068161-91068183 ATTTTTCCTCTAATGTGGTGGGG - Intergenic
1087027796 11:93668119-93668141 ATTTTTTGACAGATTTGGTGGGG + Intronic
1087160395 11:94942887-94942909 ATTTTTCCACAGATGGTGGGTGG + Intergenic
1088185713 11:107166864-107166886 CTTTTTCCACAGATGTGGTCAGG + Intergenic
1088736291 11:112730382-112730404 ATTTTTCCACTAATGGGGTGGGG - Intergenic
1089290899 11:117437532-117437554 TGTTTGGCACAGATGGGGTGGGG + Intronic
1089357914 11:117867351-117867373 ACTTTGCCACAGATGCAGTGTGG - Intronic
1089837539 11:121384236-121384258 ATTTTTCCACGGATATGGGGTGG + Intergenic
1090278874 11:125439278-125439300 ATTTTTGTACATATGGTGTGGGG - Intergenic
1090591133 11:128270211-128270233 ATTTTTCCACAGATTGGGGGTGG - Intergenic
1091755327 12:3047612-3047634 ATTTTTCCACGGATGGAGCGGGG - Intergenic
1091793264 12:3283447-3283469 CTTTGTCCCCACATGGGGTGGGG + Exonic
1091956178 12:4645420-4645442 ATTTTTCCACGGATGGGAGTGGG + Intronic
1092050056 12:5462587-5462609 ATTGTTCCATATCTGGGGTGTGG - Intronic
1092554554 12:9543196-9543218 ATTTTTCCACAGATGGGGTGGGG + Intergenic
1092734293 12:11565526-11565548 ATTTTCCCACGGATGGGGGTTGG - Intergenic
1093224538 12:16465778-16465800 ATTTTTCCACAGATTGGGGTGGG - Intronic
1093260086 12:16925244-16925266 ATTTTTCCATGGACGGAGTGGGG + Intergenic
1093411897 12:18877602-18877624 ATTTTTCCACAGATGGGGTAAGG + Intergenic
1093651698 12:21653420-21653442 ATTTTTCCACAGATGTGTGAGGG - Intronic
1093661967 12:21767580-21767602 ATTTTTCCACTGATGGGGGTGGG - Intronic
1093718942 12:22415373-22415395 ATTTTTCTAGAGATGAGGTTTGG - Intronic
1093766840 12:22973513-22973535 ATTTTTCCACAGATGAGGGTGGG + Intergenic
1094045498 12:26161713-26161735 ATTTTTCCAAAGACATGGTGTGG + Intronic
1094065411 12:26356570-26356592 AGTTTTACACAAATGGAGTGTGG + Intronic
1094167445 12:27457042-27457064 ATTTTTCCACAGACAGTGGGAGG - Intergenic
1094517545 12:31147439-31147461 ATTTTTCCACAGATGGGGTGGGG - Intergenic
1094645744 12:32322377-32322399 ATTTTTCCACAGATAGGGTGCGG + Intronic
1094719094 12:33044237-33044259 ATTTTTCCACGGATGGGGGATGG + Intergenic
1094747644 12:33364114-33364136 ATTTTTCCACAGACTGGGATGGG - Intergenic
1095184064 12:39180425-39180447 ATTTTTCCATGGATGGGGAGGGG + Intergenic
1095184370 12:39184722-39184744 ATTTTTTCACGGATGGGGGGTGG - Intergenic
1095322662 12:40847834-40847856 GTTTTTCCACGGATGGGGTGAGG + Intronic
1095393975 12:41742035-41742057 ATTTTTCCACAGATGGTGGGAGG + Intergenic
1095491051 12:42734219-42734241 ATCTTTCCATAGATGGGGGTGGG + Intergenic
1096300156 12:50419726-50419748 GTTTTTGTAGAGATGGGGTGTGG - Intronic
1096873697 12:54610997-54611019 ATTTTTCCACAGCCAGGGGGAGG + Intergenic
1097041323 12:56157870-56157892 TTTTTTCCACAGATCCAGTGGGG + Exonic
1097110562 12:56655001-56655023 ATTTTTCCATGGATGGGGGTGGG - Intergenic
1097728995 12:63106502-63106524 GTTTTTCCACAGACTGGGGGTGG + Intergenic
1098125738 12:67291018-67291040 ATTTTTCCACAGATTTGCAGGGG - Intronic
1098140465 12:67445446-67445468 ATTTTTCCACTGATGGGCAAGGG + Intergenic
1098172752 12:67763110-67763132 ATTTTTCCATAGACAGGGTGGGG - Intergenic
1099222240 12:79929050-79929072 ATTTTTCCACAGATGTGGGTTGG + Intronic
1099814322 12:87625566-87625588 ATTTTTCCACACACTTGGTGGGG - Intergenic
1099863531 12:88249349-88249371 ATTTTTCCACAGACGGGTTGGGG - Intergenic
1100123325 12:91394550-91394572 AATTTTCCACTGATAGGGTTTGG + Intergenic
1100324816 12:93530950-93530972 ATTTTTCCACAGACTGGGGTTGG + Intergenic
1100993684 12:100279149-100279171 GTTTTTCCACAGATGGGGGATGG + Intronic
1101293627 12:103397582-103397604 ATTTTTCCACAGACAAGGAGGGG - Intronic
1101375565 12:104168413-104168435 ATTCTTCCACAGATGGGAGCAGG - Intergenic
1101632999 12:106513751-106513773 ATTTAAGCCCAGATGGGGTGTGG + Intronic
1101635530 12:106537607-106537629 ATTTTTCCATAGATGGGAGTAGG - Intronic
1101861118 12:108483256-108483278 ATTTTTCCACGGACGGTGGGTGG - Intergenic
1101959188 12:109235695-109235717 ATTTTTTAAGAGATGGGATGGGG + Intronic
1102539057 12:113605327-113605349 CTTTTTGCAGAGATGGGGCGGGG + Intergenic
1102763219 12:115407687-115407709 GTTCTTCCCCAGGTGGGGTGAGG - Intergenic
1103226375 12:119291520-119291542 ATTTTTCCACAGACGGGGTCAGG - Intergenic
1103888089 12:124217644-124217666 CTGTTTCCAGAGCTGGGGTGCGG - Intronic
1104501822 12:129293446-129293468 ATTTTTCCAAAGACGGGTGGCGG + Intronic
1104722191 12:131050737-131050759 ATTTTTGCACGGATGGGGTGGGG + Intronic
1104893823 12:132152434-132152456 ATTTATTCACAGGTGGGCTGGGG - Exonic
1106346258 13:28882036-28882058 ATTTTTGTACACATGGTGTGAGG - Intronic
1106457187 13:29937670-29937692 ATTTTTCCACAGATGGGGTCCGG - Intergenic
1106474310 13:30084301-30084323 ATTTTTCCACAGATGGGGTGGGG - Intergenic
1106506625 13:30376239-30376261 ATTCTTCCACAAATGAGGTGGGG - Intergenic
1107749540 13:43549958-43549980 ATTTTTCCACAGATGGCAGCAGG + Intronic
1107797184 13:44064848-44064870 ATTTTTCCATGGATTGGGAGGGG + Intergenic
1108202717 13:48058732-48058754 AGTCTTGCACAGATGGGATGTGG - Intronic
1108222653 13:48252563-48252585 ATTTTTCCACAGACAGACTGAGG - Intronic
1108481945 13:50881519-50881541 ATTTTTTCATGGATTGGGTGGGG - Intergenic
1108487138 13:50938536-50938558 ATTTTTCCATGGATGGGGCAGGG + Intronic
1108641398 13:52385657-52385679 GTTTTTCCACAGTTTTGGTGGGG + Intronic
1110105461 13:71669570-71669592 TTTTTTCCACTGATGGGGGTGGG - Intronic
1110247498 13:73342871-73342893 GTTTTTCCACAGACAGTGTGTGG - Intergenic
1110335354 13:74323606-74323628 ATTTTCCCACAGACAGTGTGGGG - Intergenic
1110477075 13:75928610-75928632 ATTTTTCCATAGATGGCTGGGGG - Intergenic
1110509291 13:76329906-76329928 ATGTTTTCAGGGATGGGGTGGGG - Intergenic
1110717360 13:78721393-78721415 GTTTTTCCACAGACGAGGTTGGG - Intergenic
1110909038 13:80932423-80932445 GTTTTTCCACAGACTGGGGGTGG + Intergenic
1111320964 13:86628359-86628381 ATTTTTCCATGGATGGTGAGTGG + Intergenic
1112115272 13:96345663-96345685 ACTTTTCCACGGATTGGGTTGGG + Intronic
1112581392 13:100679183-100679205 ATTTTTCCATGGATGGAGTTGGG - Intergenic
1113172477 13:107520808-107520830 ATTTTTCAACACATGGGGTAAGG + Intronic
1113626694 13:111853110-111853132 ATTTCTCCACAGATGGGGGGTGG - Intergenic
1114373260 14:22113417-22113439 ATTTTTCCACGGAGAGGGTGGGG + Intergenic
1114423685 14:22604898-22604920 AATTTCACACAGATTGGGTGTGG - Intronic
1114576606 14:23719989-23720011 ATTTTTCCACAGATGGAGCAGGG - Intergenic
1114897138 14:27005020-27005042 ATTTTTCCACGGATGGGGTGAGG - Intergenic
1114977586 14:28121488-28121510 GTTTTTCAAGAGATGGGGTGGGG + Intergenic
1115053297 14:29091388-29091410 ATATTTCCACAGCTGGTGTGGGG - Intergenic
1115160084 14:30384064-30384086 AGTTAACCACAGATGGTGTGGGG + Intergenic
1115327107 14:32152202-32152224 GTTTTTCCACAGATGGGTGGGGG - Intronic
1116077500 14:40129849-40129871 ATTTTTGCTGGGATGGGGTGCGG + Intergenic
1116255572 14:42549893-42549915 ATTTTTCCACAGACTGGTGGGGG - Intergenic
1116423756 14:44764794-44764816 ATTTTTCCACAGATCAGGGGTGG - Intergenic
1117006028 14:51421894-51421916 AGCTTTACACAGATGGTGTGGGG - Intergenic
1117145234 14:52830696-52830718 ATTTTAGTAGAGATGGGGTGTGG + Intergenic
1117281145 14:54242261-54242283 ATTTTTCCACAGACTGGCAGGGG + Intergenic
1117559130 14:56917930-56917952 ATTTTTCCATATATGGGGGTGGG + Intergenic
1117628644 14:57666480-57666502 GTTCTTCCCCAGATGAGGTGAGG + Intronic
1117717248 14:58593965-58593987 ATTTTTCCACAGCTGGGGTTGGG - Intergenic
1117767743 14:59100476-59100498 ATTTTTCCACAGACTGGGTCGGG + Intergenic
1118056855 14:62087821-62087843 ATTTTACCTCAGAAGGGGAGGGG - Intronic
1118943046 14:70356188-70356210 ATTTTTCCACAGATGGTGGCGGG + Intronic
1119481931 14:74963376-74963398 TTTTTTCCCCATTTGGGGTGGGG - Intergenic
1119829846 14:77692374-77692396 ATTTGTCCATGGATGGAGTGGGG + Intronic
1120311200 14:82830602-82830624 ATGTTTCCATGGATGGGGTGGGG + Intergenic
1120428435 14:84381361-84381383 ATTTTTCCACGGATGGGGATGGG + Intergenic
1120598499 14:86471397-86471419 ATTTTGGAATAGATGGGGTGTGG + Intergenic
1120618783 14:86737561-86737583 ATTTATCCATGGATGGGGTCGGG - Intergenic
1120691806 14:87601227-87601249 TTTTTAACAGAGATGGGGTGGGG - Intergenic
1120788212 14:88555622-88555644 ATCTTTGCACAGCAGGGGTGGGG + Intergenic
1120898956 14:89559200-89559222 TTTTTTGCAGAGATGGGGTTGGG - Intronic
1120924338 14:89782784-89782806 ATTTTTCCACAGATGAGATGGGG + Intergenic
1120988534 14:90354964-90354986 ATTTTTCCACGGATGGGGAGGGG + Intergenic
1121263521 14:92583791-92583813 ATTTTTCCACAGATGGGATGGGG + Intronic
1121798241 14:96753415-96753437 ATTTTTTCACAGACTGGGTGGGG - Intergenic
1122144002 14:99677996-99678018 ATTTTTCCATGGATGGGGGTTGG + Exonic
1122170001 14:99864978-99865000 ATTTTTCCACAGAAGTGGGGCGG + Intronic
1122472767 14:101982674-101982696 ATTTTTCCACAGATGGTTGGGGG - Intronic
1122485307 14:102075581-102075603 TTTTTTGTAGAGATGGGGTGGGG - Intergenic
1124484983 15:30105698-30105720 ATTTTTCCACAGACAAGGTTGGG - Intergenic
1124518595 15:30391571-30391593 ATTTTTCCACAGACAAGGTTGGG + Intronic
1124540058 15:30574677-30574699 ATTTTTCCACAGACAAGGTTGGG - Intergenic
1124574109 15:30892648-30892670 ATTTTTCCACAGATGGGGTAAGG - Intergenic
1124758592 15:32432900-32432922 ATTTTTCCACAGACAAGGTTGGG + Intergenic
1125499715 15:40232028-40232050 GTTTTTCCACAGATGGGGGATGG + Intergenic
1126037985 15:44565330-44565352 ATTTTTCCACAGACTGGGAGGGG + Intronic
1126136182 15:45394341-45394363 ATTTTTGCACAGATGGGGTGTGG - Intronic
1127159332 15:56164978-56165000 ATTTTTCCATGGATGGGGTGGGG + Intronic
1127550831 15:60036797-60036819 ATTTTTCTACGGATGGGGGTGGG + Intronic
1127618404 15:60709850-60709872 ATTTTTCCACAGAGTGGGGCAGG - Intronic
1128014829 15:64334381-64334403 ATTTTTCCACAGACTGGGGGTGG + Intronic
1128042404 15:64586653-64586675 ATTTTTCCACAGACAGAGGGGGG - Intronic
1128652994 15:69433625-69433647 ATTTTTACACAGATGGGTTGAGG - Intronic
1129012365 15:72432478-72432500 ATTTTTGTAGAGATGGGGTTTGG + Intergenic
1129031841 15:72624457-72624479 ATTTTACCACAGACAGGGTCAGG - Intergenic
1129218103 15:74113012-74113034 ATTTTTCTACAGACGGGGTCAGG + Intronic
1129406256 15:75320565-75320587 ATTTTTCCACAGACGGGGTTGGG - Intergenic
1129735216 15:77957054-77957076 ATTTTTCCACAGACGGGGTTGGG + Intergenic
1129889036 15:79058952-79058974 ATTTTCACACCCATGGGGTGAGG - Intronic
1129985126 15:79912333-79912355 ATTTTTCCACGGACTGGGGGTGG - Intronic
1130421502 15:83751783-83751805 ATTTTTTCACACCTGGGGTTAGG - Intronic
1130918862 15:88327334-88327356 ATTTTTCCATGGATGGGTTGAGG + Intergenic
1131146124 15:90013814-90013836 ATTTTGCAACATATGGTGTGGGG - Intronic
1131360795 15:91788910-91788932 ATTTCTCCAAAGATGGAGTGAGG + Intergenic
1131672798 15:94638187-94638209 ATTTTTCCGCAGACAGGGGGTGG + Intergenic
1131706232 15:94999365-94999387 ATTTTTGTAGAGATGGGGTTTGG - Intergenic
1131839420 15:96419778-96419800 ATTTATCCTCAGATGGTGTTCGG + Intergenic
1132032118 15:98446852-98446874 GTTTTTCCACGGATGGGGCAGGG - Intronic
1132050305 15:98602210-98602232 GTTTTTCCACAGATGTGGTGTGG - Intergenic
1132076516 15:98825632-98825654 ATTTTTCCACAGATGGGTGGGGG - Intronic
1133977311 16:10608492-10608514 ATTTTTCCACAGATGGGGGTTGG - Intergenic
1134286639 16:12867688-12867710 TTTTTTGCAGAGATGGGGGGGGG + Intergenic
1134393837 16:13844117-13844139 ATTTTTCCACGAATGGTGTGTGG + Intergenic
1134459873 16:14421700-14421722 AATTTTCCACGGATGGGGGCGGG - Intergenic
1134624142 16:15712023-15712045 ATTCTCCCATAGATGGGATGTGG + Intronic
1135191405 16:20357728-20357750 ATTTTTCCAGGGATGGGGGTGGG + Intergenic
1135284607 16:21182600-21182622 ATTTTTCCATGGATGAGGCGTGG - Intergenic
1135868270 16:26125268-26125290 TTTTTTCCACAGATGGGGGTGGG + Intronic
1136137691 16:28267217-28267239 TTTTTTATAAAGATGGGGTGGGG + Intergenic
1137332393 16:47511871-47511893 AGTTTTCCACGGATGGGGTAGGG + Intronic
1137366452 16:47863649-47863671 ATTTCTACACAGATGGGGAGTGG + Intergenic
1137854188 16:51777267-51777289 AGTTCTCCCCAGATGGGGTGTGG - Intergenic
1138731300 16:59198009-59198031 ATTTTTCCACGGATGGGGCGGGG + Intergenic
1138899357 16:61250347-61250369 ATTTTTTCACGGATGTAGTGAGG + Intergenic
1139332773 16:66206643-66206665 TTTTTGATACAGATGGGGTGAGG - Intergenic
1139733377 16:68967091-68967113 ATTTTTGTAGAGATGGGGTCTGG + Intronic
1139914902 16:70421883-70421905 AGTTAACCACATATGGGGTGGGG - Intronic
1139997794 16:70996837-70996859 ATTTTTCCATGGACTGGGTGGGG + Intronic
1140013624 16:71160964-71160986 ATTTTTCCACAGATTGGGGGTGG + Intronic
1140239256 16:73186245-73186267 GTTTTTCCACAGATGGTGAGGGG - Intergenic
1140358621 16:74326400-74326422 ATTTTTCCGCAGATTGGGACGGG + Intergenic
1140522905 16:75597510-75597532 ATTTTTCCACAGATCCGGGGTGG + Intronic
1141040636 16:80669809-80669831 ATTTCTGCACACATGGGCTGTGG + Intronic
1141327741 16:83078322-83078344 ATTTTTCCACATATTGGGGACGG + Intronic
1141814115 16:86397793-86397815 ATGTGTCTACAGATTGGGTGGGG + Intergenic
1142140849 16:88472098-88472120 CTGGGTCCACAGATGGGGTGGGG - Intronic
1142435079 16:90051506-90051528 ATTTTTCCACAGATGGGCTGAGG - Intergenic
1143066066 17:4248420-4248442 GTTTGTCCATAGATGGGGTAGGG - Intronic
1143279481 17:5741809-5741831 ATTTTTCCACGGACGGGGGTGGG + Intergenic
1143727668 17:8860489-8860511 ATTTTTCCACGGAAGGGGTTTGG - Intronic
1144299233 17:13907708-13907730 ATTGTTCCACAGTTTGGCTGAGG + Intergenic
1144450143 17:15370387-15370409 ATTTTTCCACGAATGGGGAGTGG + Intergenic
1144713616 17:17419550-17419572 ATTTTTCCACAGACTGGGGGTGG - Intergenic
1145042124 17:19584781-19584803 ATTTTTGTAAAGATGGGGTCTGG + Intergenic
1145184656 17:20784056-20784078 TTTTTTGCAGAGATGGGGTCTGG - Intergenic
1146300739 17:31687185-31687207 ATTTTTCCATGGACAGGGTGTGG + Intergenic
1146393342 17:32442914-32442936 ATTTTTCCACGGATGTGAGGAGG - Intergenic
1146405440 17:32532773-32532795 ATTTTACCACAGCAGGGCTGAGG + Intronic
1146738118 17:35257101-35257123 ATTTTTTCACGGATGGGGGTTGG - Intronic
1147412405 17:40263195-40263217 ATTTTTCCATAGATGGTGGGCGG + Intronic
1147448967 17:40491942-40491964 CCTGTTCCAAAGATGGGGTGCGG + Intronic
1147642555 17:42012976-42012998 TTTTTTACAGAGATGGGGGGCGG + Intronic
1147925912 17:43945778-43945800 AGTTTTCCAGAAAAGGGGTGGGG - Intergenic
1148411727 17:47473016-47473038 TTTTTTGCAGAGATGGGGTCTGG + Intergenic
1148949040 17:51292737-51292759 ATTCATCCACAAATTGGGTGAGG + Intronic
1149020796 17:51962133-51962155 ATTTCTGCACAGAAAGGGTGGGG - Intronic
1149040968 17:52187657-52187679 ATTTTTCCATAGATAGGGGCAGG + Intergenic
1149140067 17:53421580-53421602 TTTTTTCCACAGACTGGGGGAGG - Intergenic
1149360436 17:55889412-55889434 AATTTTCCACAGATGTGGGCAGG - Intergenic
1149664070 17:58353666-58353688 ATTTATCCACAAATGTGGTCTGG - Exonic
1149808107 17:59638540-59638562 ATTTTTCCACCGGTTGGGGGTGG + Intronic
1150793891 17:68222441-68222463 ATTTTTCCACGGACCGGGTGGGG + Intergenic
1151200336 17:72463351-72463373 ATTTTTCCGTGGATGTGGTGGGG - Intergenic
1151279525 17:73062729-73062751 GTTTTTCCACGGATTGGGGGTGG + Intronic
1151413489 17:73946701-73946723 ATTTTTCCATGGGTGGGGTGGGG - Intergenic
1151442297 17:74138095-74138117 ATTTTTCCACGGACAGTGTGGGG + Intergenic
1151506094 17:74528245-74528267 ATTTTTCCACATCAGGAGTGGGG - Intronic
1151573724 17:74940720-74940742 ATTTTTCCATGGATGGAGGGTGG - Intronic
1151836711 17:76586648-76586670 ATTTTTCCACGGAGGGGGGTGGG + Intronic
1153246964 18:3081975-3081997 ATTTTTCCACAGACCAGGTCGGG + Intronic
1153357137 18:4149799-4149821 ATTTTTCCACGGACAGGGTGGGG - Intronic
1153533812 18:6078695-6078717 ATTTTTCCACAGACCAGGGGTGG + Intronic
1153677095 18:7465495-7465517 TTTTCTCCACAGATGGGGGGAGG + Intergenic
1153693321 18:7615685-7615707 ATTTTTCCACAGATGGGGTGGGG + Intronic
1153912209 18:9714239-9714261 ATTTTTCCACAGATGGGAGCAGG + Intronic
1154045628 18:10902202-10902224 ATTTTTCCACGGATGGGGGTAGG - Intronic
1154205142 18:12329699-12329721 ATTTTTCCGCAAATGGTCTGGGG + Exonic
1154236240 18:12608955-12608977 ATTTTTCCACAAATGGGGGTGGG + Intronic
1155320182 18:24611470-24611492 ATTTTTCCATGGATGGGGTGGGG - Intergenic
1155459966 18:26067851-26067873 ATTTTTCCACTGATGGTGGCCGG + Intronic
1155908299 18:31478795-31478817 ATTTTTCCACAGACGGCGGCAGG + Intergenic
1155971012 18:32083732-32083754 ATTTTTGTAGAGATGGGGTTTGG - Intergenic
1156419108 18:36931490-36931512 ATTTTTCCACAGACATTGTGGGG - Intronic
1156426604 18:37020053-37020075 ATCTCTGCACAGGTGGGGTGGGG + Intronic
1156774664 18:40772372-40772394 ATTTTTCCATGGATGGGGGATGG + Intergenic
1157171409 18:45409818-45409840 ATTTTTCCACAGACCGGGGTTGG + Intronic
1157375624 18:47161688-47161710 ATTTTTCCACAGATGGGTTGGGG + Intronic
1157513848 18:48297040-48297062 AATTTTCCACAGACGGGGTGGGG - Intronic
1157635438 18:49148870-49148892 ATTTTTCCACGGATGCAGGGTGG + Intronic
1157733099 18:50021702-50021724 TTTTTTACGCAGATGGGATGGGG - Intronic
1157986886 18:52448282-52448304 ATTTTTCCACAGAGGGGCCAGGG - Intronic
1158862893 18:61610378-61610400 ACTTTTCCACAGACGCGGAGGGG + Intergenic
1158940902 18:62405298-62405320 ATTTTTCCACAGATGGGCTGGGG + Intergenic
1159021773 18:63149190-63149212 ATTTTTCCACGAATGGGGTGGGG + Intronic
1159324586 18:66897863-66897885 ATTTTTCCACAGATGGTTGGGGG - Intergenic
1160192521 18:76725809-76725831 GTTTTTCCACAGATGGTGGCAGG + Intergenic
1160281391 18:77494047-77494069 ATTTTTCCACAGATGAGATTGGG - Intergenic
1160334259 18:78023490-78023512 ATTTTTCCACAGACTGGGAGCGG + Intergenic
1160727554 19:624262-624284 ACTCATCCACAGATGGGGAGGGG + Intronic
1160948918 19:1656374-1656396 ATTTTAGCAGAGATGGGGTGAGG + Intergenic
1161431016 19:4232543-4232565 TTTTTTCTACAGATGGGGGGGGG - Intronic
1161564291 19:4991261-4991283 ATTTCACCACAGATGGGGGTAGG - Intronic
1161903654 19:7138552-7138574 TTTTTTGCAGAGATGGGGTCTGG + Intronic
1161976284 19:7609573-7609595 ATTTTTCCACAGATGGAGGCAGG + Intronic
1162389687 19:10381835-10381857 ATTTTTGTAGAGATGGGGTCTGG + Intergenic
1162713317 19:12612214-12612236 TTTTTTTAACAGATGGGGTCTGG + Intronic
1162952018 19:14076864-14076886 TTTTTTGTAGAGATGGGGTGGGG - Intergenic
1163127637 19:15252885-15252907 GTGTGTGCACAGATGGGGTGGGG - Intronic
1163744657 19:19038319-19038341 ATTTTTCCATGGATATGGTGGGG - Intronic
1163938427 19:20471562-20471584 ATTTGTGCACAGATGAGGAGAGG + Intergenic
1164318776 19:24119152-24119174 ATTTTTCCACATATGGTTTAAGG + Intronic
1164794038 19:31012080-31012102 GTTTTTCAACAGATGGGGGAGGG - Intergenic
1164941721 19:32256170-32256192 ATTTTTTCAGAGATAGGGTGTGG - Intergenic
1165210321 19:34230704-34230726 GTTTTTCCACAGATGAGCAGGGG + Intergenic
1165242478 19:34479903-34479925 ATTTTTCCACAGACAGGGATGGG - Intergenic
1165410406 19:35657043-35657065 GTTTTTCCACAGACAGGGTTGGG + Intronic
1165479244 19:36052414-36052436 GTTTTTCCACGGATGGGATAGGG - Intronic
1165506948 19:36239056-36239078 ATTTTTCCACGGACGGTTTGTGG - Intronic
1165857005 19:38885271-38885293 ATTTTTGTAGAGATGGGGGGTGG + Intronic
1166202410 19:41246730-41246752 ATTTTTTTAGAGATGGGGTCTGG + Intronic
1166612886 19:44215068-44215090 ATTTTTCCACGGATGGGGGCGGG - Intronic
1166689946 19:44816384-44816406 AGTTGTCCCCAGTTGGGGTGAGG + Intronic
1166715857 19:44967139-44967161 TTTTTTACAGAGATGGGGTCAGG - Intronic
1167276321 19:48542216-48542238 ATTTTTGTAGAGATGGGGTCTGG - Intergenic
1167430600 19:49452116-49452138 TTTTTTTAAGAGATGGGGTGTGG - Intronic
1168217314 19:54935899-54935921 TTTTTTCCACAGACGGGTTTGGG - Intronic
1168402668 19:56094736-56094758 ATTTTTCCACGGACAGGGTGGGG + Intronic
1168434275 19:56304854-56304876 CTTTTCCCACCGCTGGGGTGGGG + Intronic
1168634928 19:57988769-57988791 ATATTTCCAGGGATGGAGTGAGG + Intronic
925007077 2:451923-451945 GTTTTTCCACGGATGGGATGGGG + Intergenic
925241634 2:2336003-2336025 ATTTTTCCACAGAACGTGTCGGG - Intergenic
926176422 2:10596237-10596259 AGTTTTCCACAGATGGTGGTGGG + Intronic
926177122 2:10603984-10604006 ATTTTTCCACGGATGCAGGGAGG + Intronic
926286547 2:11493292-11493314 ATTTTTCCACAGACAGGGTGTGG + Intergenic
926880903 2:17542433-17542455 ATTTTCCCTCAAATCGGGTGTGG + Intronic
927228063 2:20789876-20789898 ATTTTTCCACAGACTGGGGAGGG - Intronic
927246585 2:20961502-20961524 GTTTTTCCACAGTTGGGTAGAGG - Intergenic
927259452 2:21072449-21072471 GTTTTTCCACGGATGGGGATCGG + Intergenic
927505112 2:23607823-23607845 ATTTTTCCATGGATGGGGCTGGG - Intronic
928252343 2:29692434-29692456 ATTTTTCCACGGATGGTTTTGGG + Intronic
928323946 2:30305208-30305230 TTTTTTCCAGAGATAGGGTCTGG + Intronic
928382012 2:30826123-30826145 TTTTTTCCACAGTTGTGGTACGG - Intergenic
928675259 2:33644670-33644692 ATTTTTCCACAGACTGGGAGTGG - Intergenic
929008302 2:37416526-37416548 ATTTTTCCACAAAGGGAGGGTGG - Intergenic
929087434 2:38182342-38182364 ATTTTTCTACAGATGCGTTGGGG - Intergenic
929334498 2:40724436-40724458 ATTTTTCCACAGACCAGGAGTGG - Intergenic
929417357 2:41756966-41756988 ATTTTTCCACAGACTGGAGGGGG + Intergenic
929530156 2:42745553-42745575 ATTTTTACAGAGATGGGGGCAGG + Intronic
929854454 2:45624738-45624760 ATTATGCCACAGCTGGGTTGTGG + Intergenic
930706689 2:54511475-54511497 GTTTTTCCACTGACGGGTTGTGG + Intronic
930776673 2:55179283-55179305 ATGTTTCCACAGAGAGGCTGAGG - Intronic
931542244 2:63342005-63342027 ATTTTTCCATGGATGGGGTGGGG + Intronic
932725367 2:74175384-74175406 ATTTTTCCACAGATCTGGTTGGG - Intronic
932754157 2:74394101-74394123 ATCTTTCCACAGACTGGGTTGGG + Intergenic
932959979 2:76402245-76402267 ATTTTTCCACAGGTGGTGGCAGG - Intergenic
933056998 2:77683133-77683155 ATTTTTCCACAGATGGGGCACGG + Intergenic
933652573 2:84861172-84861194 ATTTTTCCACAGAGCAGGTGAGG + Intronic
933776383 2:85773646-85773668 CTTTTTCCACTGCTGGGGTGAGG - Intronic
933927130 2:87104276-87104298 ATTTTTCCACAGATGGGGCACGG + Intergenic
933984396 2:87578510-87578532 ATTTTACCACAGATGTGTTGAGG - Intergenic
935016272 2:99185214-99185236 ATTTTTCCACAGATAGGGAGGGG - Intronic
935327612 2:101951399-101951421 ATTTTTCCACTGATGGACTTTGG - Intergenic
935433121 2:102999385-102999407 ATTTTTCCACAGATGAGGTGTGG - Intergenic
935565161 2:104598525-104598547 ATTTTTCCACAGACTGGGTAGGG + Intergenic
935611190 2:105027381-105027403 ATTTTTCCACCAATGGTGTTTGG + Intergenic
936309458 2:111372290-111372312 ATTTTACCACAGATGTGTTGAGG + Intergenic
937167202 2:119831042-119831064 ATTTTTCCATGGATGGGGGGTGG + Intronic
937217427 2:120321545-120321567 TTTTTTGTAGAGATGGGGTGAGG + Intergenic
937421526 2:121760311-121760333 ATTTTTCCACAGAAGGGGGGCGG - Intronic
937850333 2:126626679-126626701 ATTTTTCCACAGACTGGGTGGGG + Intergenic
938985373 2:136570414-136570436 GTTTTTCCACAGATGTGGATGGG + Intergenic
939370428 2:141292236-141292258 ATTTTTCCACAGACCGGGATGGG - Intronic
940039468 2:149345102-149345124 CTTTTTTCAGAGATGGGGTCGGG - Intronic
940316665 2:152334919-152334941 AGTATTCCACTGTTGGGGTGAGG + Intergenic
940453269 2:153867539-153867561 ATTTTTCCACAGACTGGGAGAGG + Intergenic
940623940 2:156149282-156149304 ATTTTTGCATGGATGGGGTGGGG - Intergenic
940948463 2:159645381-159645403 ATTTTCCCACAGATGGAGCAAGG + Intergenic
941225569 2:162842714-162842736 CTTTTTCTATAGATGGGGTCTGG + Intergenic
941367308 2:164623102-164623124 ATTTTTCCACGGATGGGGTGGGG - Intergenic
941389006 2:164888901-164888923 TTTTTTGTAGAGATGGGGTGGGG + Intergenic
941547356 2:166868508-166868530 ATTTTTCCACGAGTCGGGTGGGG - Intergenic
941784961 2:169488223-169488245 GTTTTTCCACGAATTGGGTGAGG + Intronic
942104937 2:172624524-172624546 ATTTTTCCATGGATGGTGTTCGG - Intergenic
942233421 2:173880906-173880928 TTTTTTCTACAGGTGGGCTGAGG - Intergenic
942497752 2:176557649-176557671 ATTTTTCCACAGATGTTGGGGGG - Intergenic
942549810 2:177103629-177103651 ATTTTTCCACAGACCGGGCTGGG + Intergenic
942810013 2:179987927-179987949 ATTTTTCCACAGATGTTAGGGGG + Intronic
943074884 2:183181854-183181876 CTTTTTCAACAAATGTGGTGAGG - Intergenic
943156609 2:184187508-184187530 ATTTTTCCACATATGGGAGTGGG + Intergenic
943162298 2:184269847-184269869 ATTTTTCCATGGATGGGGGTGGG + Intergenic
943256732 2:185602996-185603018 ATTTTTACACGGATGGGGTTGGG - Intergenic
943294326 2:186117592-186117614 ATTTTTCCACAGACCGGAGGTGG + Intergenic
943369731 2:187002198-187002220 ATTTCTTCTCAGATGGGGTGCGG - Intergenic
943464446 2:188211143-188211165 ATATTTACACAGACCGGGTGCGG - Intergenic
943509707 2:188809378-188809400 ATTTTGCCTGAGATGGGTTGAGG + Intergenic
943648839 2:190435068-190435090 ATTTTTCCTCAGATGGAGAGGGG - Intronic
943776570 2:191772944-191772966 ATTTTTCCACAGAGGAGTGGGGG - Intergenic
944068754 2:195646887-195646909 CTTTTTCCACAGATGGCAGGGGG - Intronic
944069463 2:195653020-195653042 ATTTTTCCACAGATGGGGGTGGG - Intronic
944293111 2:198030430-198030452 GTTTTTCCACAGTTGGGGAAAGG + Intronic
944311637 2:198240151-198240173 ATTTTTCTACAGACAGGGTGGGG - Intronic
944886153 2:204064638-204064660 ATTTTTCCACACACTGGGGGTGG - Intergenic
945933450 2:215879804-215879826 ATTTTTCCACAGATGGTGGAGGG + Intergenic
946383463 2:219365751-219365773 ATTTTTGTATAGATGGGGTTTGG + Intergenic
946502751 2:220267200-220267222 ATTTTTCCATGGATGGTGGGTGG + Intergenic
946649472 2:221875250-221875272 ATTTTTCCACGGATGGGGGTAGG - Intergenic
946732695 2:222724445-222724467 AATTTTCCAAAAAAGGGGTGTGG + Intergenic
946739797 2:222790248-222790270 ATTTTTCCACAGACGGTGGCAGG + Intergenic
947000875 2:225454776-225454798 CTTTTTCCACAGATGGGGAGGGG - Intronic
947157336 2:227175599-227175621 ATTTTGCTACAGGTGAGGTGGGG + Intronic
947208249 2:227682224-227682246 ATTTTTCCACGGACTGGGTGGGG + Intergenic
947214971 2:227741940-227741962 ATTTTTGTAGAGATGGGGTCTGG - Intergenic
947829411 2:233128252-233128274 ATTATTCCACGGATGGGTGGTGG - Intronic
948212482 2:236204937-236204959 ATTTTTTAACAGATGGGATGTGG - Intronic
948306572 2:236952615-236952637 ATTTTTCCGCAGACCAGGTGGGG - Intergenic
948535789 2:238645686-238645708 ATTTTTCCACAGACCGGGGAAGG - Intergenic
948539806 2:238682525-238682547 ATTTTTCCACAGATGGGGCTGGG + Intergenic
1168840622 20:907779-907801 ATTTTCCCAAAGTTGAGGTGAGG - Intronic
1169254614 20:4087259-4087281 ATTTTTCCTCAGACGGGGTAGGG + Intergenic
1169322050 20:4640987-4641009 ACTTTTCCACAGATGGGTGGGGG - Intergenic
1169469912 20:5875528-5875550 ATTTTTTAAGAGATGGGGTCTGG - Intergenic
1169471423 20:5888882-5888904 ATTTTTCCAAAAGTGGGGTCAGG + Intergenic
1169640006 20:7741245-7741267 ATTTTTCCACAGATAGTGGTGGG + Intergenic
1169785649 20:9356936-9356958 TTTTTTGCAGAGATGGGGTCTGG - Intronic
1169946709 20:10996731-10996753 ATTTTTTCACGGACGGGGTTGGG - Intergenic
1170187035 20:13602591-13602613 ATTTTTCCATGGATGGGGTGGGG + Intronic
1170453317 20:16508440-16508462 ATTTTTCCACAGATAGGGGTAGG + Intronic
1170501988 20:16983288-16983310 ATTTTTCCACGGAGTGGGGGTGG - Intergenic
1171162340 20:22939163-22939185 TTTTTTCCACAGATAGAGGGAGG - Intergenic
1171869197 20:30512562-30512584 ATTTTTTCACTGATCTGGTGAGG - Intergenic
1172575508 20:36005221-36005243 ATTTTTTCACAGATGGGGGCAGG + Intronic
1172627254 20:36354308-36354330 TGTTTTCTACAGATGGGGTCTGG - Intronic
1172914778 20:38435264-38435286 AGATTTCGAGAGATGGGGTGCGG + Intergenic
1173072055 20:39777704-39777726 ATTTTTCTGCAGATGCTGTGGGG + Intergenic
1173697209 20:45028502-45028524 TTTTTTCCAAAGATGAGGTCTGG + Intronic
1173926016 20:46781818-46781840 GTTTTTCCACAGATGGGGGCAGG + Intergenic
1174253869 20:49239474-49239496 ATGTTTCCACATTTGGGGTGTGG + Intronic
1174906459 20:54557262-54557284 ATTTTTCCACAGACGGGGTTGGG + Intronic
1175651653 20:60729898-60729920 ATTTTTCCATGGACGGGGTTGGG - Intergenic
1175834046 20:61982308-61982330 GTGTTTCCTCGGATGGGGTGTGG - Intronic
1176088731 20:63309635-63309657 ATCTGTCCACAGAAGGGCTGGGG + Intronic
1176308532 21:5137055-5137077 ATTTTTCCACAGACAGGGTTGGG - Intronic
1176973818 21:15295703-15295725 ATTTTTCCTCGGACGGGGGGTGG + Intergenic
1177679186 21:24341810-24341832 AATTTTTCACAGATGGGGGAAGG + Intergenic
1177805208 21:25868533-25868555 ATTTTTCCACAGACCAGGAGTGG + Intergenic
1177977759 21:27872316-27872338 ATCTTTGCACAGAAGAGGTGGGG + Intergenic
1178319776 21:31596583-31596605 ATTTTTCCATACATGGGGGTGGG - Intergenic
1178415932 21:32405116-32405138 ATTTTTCCAAAGATGGGGGTTGG + Intergenic
1178462413 21:32815065-32815087 ATTTTTCCACAGACAGGCAGGGG - Intergenic
1178475030 21:32930534-32930556 ATTTTTCCATGGATGGGGTGCGG + Intergenic
1178786064 21:35654775-35654797 ATTGATACACTGATGGGGTGGGG + Intronic
1179525692 21:41974520-41974542 AGTTTTCCTCAGAGGGGATGAGG + Intergenic
1179848527 21:44124977-44124999 ATTTTTCCACAGACAGGGTTGGG + Intronic
1179898073 21:44374380-44374402 GTTTTTCCACAGATGGGGGCGGG + Intronic
1180100742 21:45583764-45583786 ATTTTTCCACAGATGAGGGGTGG + Intergenic
1180936182 22:19626755-19626777 ATTTTTCCACAGACCGAGGGTGG - Intergenic
1180938513 22:19641716-19641738 ATTTTTCCACCGATGGGGTTGGG - Intergenic
1181020111 22:20095653-20095675 ATTTTTCCACAGACGGTGTTGGG + Intronic
1181846830 22:25717010-25717032 ATTTTTCCACAGACGGGGATGGG - Intronic
1182184715 22:28390274-28390296 ATTTTGGAACAGGTGGGGTGTGG + Intronic
1182635597 22:31724308-31724330 GTTTTTCCACAGATCTGGTGGGG - Intronic
1183503663 22:38196443-38196465 ACTTTTCCACAGATGAGGGTGGG + Intronic
1183621577 22:38976223-38976245 ATTTTTCCACTGACAGGGTGAGG - Intronic
1184053733 22:42029547-42029569 ATTTTTATAGAGATGGGGTCTGG + Intronic
1184142491 22:42586005-42586027 GTTTTTCCTTAGATGGGGAGGGG + Intronic
1184706306 22:46215943-46215965 ATTTTTCCACAGATGGGGGTGGG - Intronic
949258340 3:2077440-2077462 TTTTTTGCAGAGATGGGGTCTGG - Intergenic
949333781 3:2951238-2951260 ATTTTTCCACAGATGGCGGGTGG + Intronic
949395310 3:3608490-3608512 ATTTTTCCACAGACCTGGGGAGG - Intergenic
950191517 3:10979966-10979988 CATTTTGCAGAGATGGGGTGGGG + Intergenic
950214011 3:11145089-11145111 AGTAATCCACAGATGGGGTATGG - Intronic
950408586 3:12819951-12819973 ACTTTCCCAGAGATGGGGAGGGG + Intronic
950831423 3:15879228-15879250 ACTTCTTCTCAGATGGGGTGTGG + Intergenic
950952825 3:17018537-17018559 TTTTTTCAACAGATGGGGCCTGG + Intronic
951052824 3:18113818-18113840 TTTTTACCTCAGATGGTGTGGGG + Intronic
951551427 3:23878909-23878931 ATTTTTCCACAGATGGGGGGTGG - Intronic
951553621 3:23899024-23899046 ATTTTTCCACAGATGGAGATGGG - Intronic
952248705 3:31627382-31627404 ATTTTTCCACGGATGGCGGAGGG - Intronic
952459005 3:33504656-33504678 ATTTTTCCACGGATGGGGAAGGG + Intronic
952600232 3:35071106-35071128 TTTTTTCCACAGAAGGGTTAGGG - Intergenic
953227422 3:41033443-41033465 ATTTTTCCACGGATGGGGGAAGG + Intergenic
953531798 3:43746152-43746174 ATTTTTCCATGGATGGTGTGGGG + Intergenic
953707015 3:45238882-45238904 ATTTTTCCACACATGGGGTAGGG - Intergenic
953874379 3:46657659-46657681 ATTTTTCCACAGACTAGGGGCGG - Intergenic
953940133 3:47087323-47087345 ATTTTTCAACAAACTGGGTGGGG + Intronic
954055243 3:48017893-48017915 ATTTTTCCACAGATAGCAGGAGG + Intronic
954308854 3:49748749-49748771 ACTTTTCCACAGAACGGGTGTGG + Intronic
954725032 3:52601309-52601331 ATTTTTCCACAGACAGGGATGGG + Intronic
955192475 3:56774133-56774155 TTTTCTCTACAGAAGGGGTGGGG - Intronic
955204065 3:56879219-56879241 AGTTTTCCACTGACCGGGTGGGG - Intronic
955217894 3:56999626-56999648 ATTTTTGTAGAGATGGGGTCTGG - Intronic
956298244 3:67738227-67738249 CTTTTTCCACAGATGGGCTGGGG + Intergenic
956335819 3:68162270-68162292 ATTTTTCCACAGATGGGGTTGGG + Intronic
957346357 3:78966200-78966222 ATTTTTCCACAGACAGAGAGGGG - Intronic
957801585 3:85090885-85090907 ATTTTTCCACAGATGGAAAGGGG - Intronic
957833519 3:85554094-85554116 ATTTTTCCACAGAAGTAGTCAGG + Intronic
957856172 3:85881795-85881817 ATTTTTCCATGGATGGTGGGCGG + Intronic
958118494 3:89254495-89254517 AGTTTTACACAGATAGGATGTGG - Intronic
958189186 3:90162623-90162645 ATTTTTCCACAGATTGGTGGTGG + Intergenic
958411498 3:93822255-93822277 ATTTTTCCACAGATTGCTTGGGG + Intergenic
959087829 3:101869835-101869857 GTTTTTCCATGGATGGGCTGTGG + Intergenic
959106531 3:102071160-102071182 ATTTTTCCATGGATGGGGGAGGG + Intergenic
959260579 3:104074610-104074632 AATTTTCCACAGATGTAGAGAGG + Intergenic
959531013 3:107433538-107433560 CTTTTTGCAGAGATAGGGTGGGG - Intergenic
959848757 3:111063912-111063934 ATTTTTGTAGAGATGGGGGGGGG - Intergenic
960086139 3:113593462-113593484 ATTTTTCCACAGACGGGGGTGGG - Intronic
960443174 3:117714560-117714582 ATTTTTCCATGGATGGGAGGGGG - Intergenic
960461043 3:117936324-117936346 TTTTTGCCATAGATGAGGTGGGG - Intergenic
960640272 3:119816641-119816663 ATTTTTCTAGAGTTGGGGTCTGG - Intronic
960796318 3:121492040-121492062 ATTTTTCCACAGACCGGGGGTGG - Intronic
960960199 3:123065356-123065378 AGTTTTCCACAGATGGTGGGGGG + Intergenic
961199629 3:125033969-125033991 ATTTTTCCACGGATAGGGCGGGG - Intronic
961230559 3:125303788-125303810 GTTTTTCCACGAATGGGGTGGGG - Intronic
961488775 3:127236253-127236275 AATTTTCCACAGATGAGGGGAGG - Intergenic
961580809 3:127880478-127880500 ATTTTTCCACTGATGAGGGTGGG + Intergenic
961646578 3:128395894-128395916 TTTTTTCCTCAGTTGGGGTGAGG - Intronic
961727263 3:128939718-128939740 ATTTTTCCACGGACGGGGTTGGG + Intronic
961842044 3:129722408-129722430 ATTTTTCCACAGATGGGGTCGGG - Intronic
962002097 3:131308829-131308851 ATTTTTCCAAGGATTGGGTGGGG + Intronic
962143692 3:132817820-132817842 ATTTGTTGACAGATGGGTTGTGG + Intergenic
962154862 3:132935342-132935364 GTTTTTCCAAGGATGGGGTTGGG - Intergenic
962468842 3:135687198-135687220 ATTTTTCCACAGACTGGGCAGGG - Intergenic
962574628 3:136745439-136745461 ATTTTTCCACGGATGGGGTGGGG + Intronic
962635220 3:137324326-137324348 AATTTTCCACTGATGGGATTTGG + Intergenic
962754336 3:138456754-138456776 ATTTTCCCACAGACCGGGGGTGG - Intronic
962857655 3:139363465-139363487 ATTTTTCCACAGATGGGAAGGGG - Intronic
962950735 3:140216215-140216237 ATTTTTCCATGGATGGGGGTGGG - Intronic
963305515 3:143648301-143648323 ATTTTTCCACGGATTGGGGGAGG + Intronic
963624817 3:147658246-147658268 ATTTTTCCACAGACCTGGAGTGG + Intergenic
964209624 3:154212579-154212601 ATTTTTCCACAGACGGGTGGGGG + Intronic
964264034 3:154873925-154873947 ATTTTTCCACAGATGGGGTCAGG - Intergenic
964517847 3:157531964-157531986 GTTTTTACACAGTTGAGGTGAGG - Intronic
964583115 3:158261995-158262017 ATTTTTCCATGGATGGGGCTGGG - Intronic
965106438 3:164361279-164361301 AATTTTCCATAAATGAGGTGTGG - Intergenic
965569857 3:170161406-170161428 ATTTTTCCACAGAGAAGGTGGGG + Intronic
965946069 3:174242802-174242824 ATTTTTCCATGGATGGGGGCGGG - Intronic
965971170 3:174558329-174558351 GTTTTTCCACAGACTGGGTACGG + Intronic
966158696 3:176945857-176945879 TTTTTTCCATGGATGGGGGGTGG - Intergenic
966163400 3:176991079-176991101 ATTTCTCCACAGACTGGGGGTGG + Intergenic
966358439 3:179107447-179107469 ATTTTTCCACAGACTGGGGTAGG + Intergenic
966459969 3:180165768-180165790 ATCTCTGCACAGAAGGGGTGGGG + Intergenic
966510857 3:180761499-180761521 ATTTTTCCACACAAGGGATTGGG - Intronic
966563713 3:181352226-181352248 GTTTTTCCACAGATGGGAGTAGG + Intergenic
967056053 3:185829278-185829300 ATTTTTCCACAGACAGGTTGGGG + Intergenic
967455160 3:189676862-189676884 ATTTTTCCACTGATGTTGGGGGG - Intronic
967671417 3:192239764-192239786 ATTTTTCCACAGACTAGTTGGGG - Intronic
968789553 4:2650219-2650241 ACTTTTCCACAGACCAGGTGAGG - Intronic
969695741 4:8733298-8733320 ATTTTTCCACAGACCAGGTTGGG - Intergenic
969925938 4:10585925-10585947 GTATTTCCACAGATGGGGGTGGG + Intronic
970038807 4:11772501-11772523 ATTTTTCCACAGACTGGGATGGG + Intergenic
970514153 4:16810941-16810963 ATTTTTCCACAGACTGGTGGGGG + Intronic
970690395 4:18612965-18612987 ATTTTTCCACAGATGAGGGTTGG + Intergenic
970900485 4:21152902-21152924 ATTTTTCCACAGACAGGGTTGGG - Intronic
971384921 4:26133738-26133760 ATTTTTCCATAGACTGGGGGCGG - Intergenic
971879476 4:32351559-32351581 AGTTTTCCACAGATGGGCAGAGG + Intergenic
972410075 4:38784690-38784712 GTTTTTCCACAGACCGGGTTTGG - Intergenic
972514314 4:39797900-39797922 ATTTTTGCAGAGGTGGGGTTTGG + Intergenic
972670444 4:41209937-41209959 ATTTTTCCACGGATGGGGTTGGG + Intronic
972675090 4:41252316-41252338 ATTTTTCCACGGACTGGGGGTGG + Intergenic
972744837 4:41922761-41922783 ATTTTTCCACAGACGGGAGTAGG - Intergenic
972824095 4:42736649-42736671 ATTTTCCCAGACATGGAGTGAGG + Intergenic
972975720 4:44633160-44633182 ATTTTTCCACAGCCAGGTTGGGG - Intronic
973095968 4:46200177-46200199 GTTTTTCCACAGATGTTGGGTGG - Intergenic
973117467 4:46478878-46478900 ATTTTTCCACGGACGGGGATGGG - Intergenic
973212458 4:47631672-47631694 ATTTTTCCACAGACTGGGATGGG - Intronic
973242650 4:47973242-47973264 ATTTTTGTAGAGATGGGGTGTGG + Intronic
974195229 4:58565654-58565676 ATTTGTCCACTGATGATGTGAGG + Intergenic
974939214 4:68443494-68443516 ATTTCTCCATAGATGTGCTGTGG - Intergenic
975070688 4:70133850-70133872 ATTTTTCCACGGATGAGGGCGGG - Intronic
975646952 4:76555176-76555198 ATTTTTCCACGGATGGGGTGTGG - Intronic
975725328 4:77285957-77285979 ATTTTTCCACAGAAGGGTCTGGG + Intronic
975857684 4:78641951-78641973 ATTTTTCCACAGACAGGTTGGGG + Intergenic
976342349 4:83959249-83959271 ATTTTTCCACAGACAGGGAGTGG + Intergenic
976398952 4:84586214-84586236 TTTTTTCCACGGATGGGTTGGGG + Intronic
976417901 4:84800683-84800705 ATTTTTTCACAGATGGATTGTGG + Intronic
976674596 4:87690562-87690584 ATTTTTCCATGGATGGGGTGAGG - Intergenic
976942407 4:90719466-90719488 ATTTTTCCACAAAGTGGGAGGGG - Intronic
977235181 4:94499948-94499970 ATTTTTCCACAGGTGGGTCAGGG - Intronic
977437927 4:97023633-97023655 ATATTTCCATAGATCAGGTGAGG - Intergenic
977475962 4:97509960-97509982 ATTTTTCCACGGATTAGGGGTGG - Intronic
977775438 4:100914079-100914101 TTTTTTCCACAGACTGGGGGAGG - Intergenic
977923585 4:102672852-102672874 GTTTTTCTACAGATTGGGGGTGG - Intronic
977957946 4:103052141-103052163 ATTTTTCCACTGATGGCAGGGGG + Intronic
979055157 4:115984248-115984270 ATTTTTCCACAGGCAGGGTGTGG - Intergenic
979161303 4:117464656-117464678 ATTTTTCCAGGGACCGGGTGGGG - Intergenic
979253909 4:118592365-118592387 TTTTTTCTAGAGATGGGGTGGGG + Intergenic
979335074 4:119453978-119454000 TTTTTTCTAGAGATGGGGTGGGG - Intergenic
979485306 4:121263723-121263745 TTTTTTGCACAGATGGGGCAAGG + Intergenic
979651467 4:123136964-123136986 ATTTTTCCACAGGTGTGGGGCGG + Intronic
979661519 4:123261088-123261110 ATTTTTCCACAAATGGGGTGGGG - Intronic
979791012 4:124781128-124781150 ATTTTTCCACAGACTGGCAGTGG - Intergenic
979920797 4:126493414-126493436 ATTTTTCCACAGATGAAGTAGGG + Intergenic
980501115 4:133655629-133655651 GTTTTTCTACAGATGGGGCATGG + Intergenic
980602874 4:135047599-135047621 ATTTATTCACAGATGATGTGGGG - Intergenic
980822834 4:138038980-138039002 ATTTTGCCACTGATGGCATGGGG - Intergenic
980910860 4:138993108-138993130 ATTTTTCCACGGACGGGGTGGGG - Intergenic
981152517 4:141395753-141395775 ATTTTTCCATGGACTGGGTGGGG + Intergenic
981734741 4:147937072-147937094 ATTTTTCCACCGATTGGGGTGGG - Intronic
981786308 4:148483110-148483132 ATTTTTCCACAGACTGGGGTGGG - Intergenic
982054068 4:151529892-151529914 AGTTTTTCAAAGATGAGGTGGGG + Intronic
982086303 4:151840212-151840234 ATTTTTCCACAGACTGGGGGTGG - Intergenic
982102198 4:151978778-151978800 ATTTTTCCACAGACGTTTTGGGG + Intergenic
982782638 4:159507105-159507127 ATTTTTCTACAGGTTGGGTTGGG + Intergenic
982842722 4:160212202-160212224 ATGTTCCCACAGCTAGGGTGTGG - Intergenic
982858221 4:160412719-160412741 ATTTTTCCACAGACTGCGTGGGG - Intergenic
982896920 4:160942005-160942027 AGTTTTCCACAGATGGGGGTGGG + Intergenic
983040859 4:162924043-162924065 ATGTTTCCATAGATGGGGGTGGG - Intergenic
983251818 4:165354241-165354263 ATTTTTTCACAGACGGGGTGGGG + Intergenic
983700095 4:170581397-170581419 ATTTTTCCACAGAAGGGGCCAGG + Intergenic
983923943 4:173376018-173376040 ATTTTTGCACAGATTGAGGGTGG - Intronic
984072933 4:175139036-175139058 ATTTTTCCACAGACTGGGGTGGG + Intergenic
984364929 4:178786273-178786295 ATTTTTCCATGGATGGGGGGTGG + Intergenic
984385269 4:179047845-179047867 ATTTTTCCAGGGATGGTGGGTGG + Intergenic
984609289 4:181819594-181819616 AATTTTCCACAGATGGAGGGTGG + Intergenic
984736082 4:183109453-183109475 ATTTTTCCACAGAATGGGATTGG + Intronic
985530012 5:428583-428605 ATTTTTCCACAGACTGGGAGTGG + Intronic
985624028 5:975278-975300 ATTTTTCCACTGATGGAGAAGGG - Intergenic
985636900 5:1040223-1040245 AGTTTTCCACGGACGGGGTGTGG - Intergenic
985887315 5:2689634-2689656 ATTTTTCCATAGATGGGGCAAGG - Intergenic
986306872 5:6522736-6522758 ATTTTTCCAGAGATGGAGGCTGG + Intergenic
986418882 5:7556876-7556898 ATTTTTCCACGGATGAGGTGGGG - Intronic
986652984 5:9982884-9982906 TTTTCTCCAGACATGGGGTGAGG - Intergenic
986757394 5:10851048-10851070 ATTTTCCCACCTATGGGGAGTGG - Intergenic
986969497 5:13315570-13315592 AGCTTTCCACAGATTGGGTTTGG - Intergenic
987012869 5:13784966-13784988 ATTTTTCCACGGATGGGACGGGG + Intronic
987035250 5:14012807-14012829 GTTTTTCCACAGGTGGGGCAGGG + Intergenic
987134977 5:14892002-14892024 ATTTTTCCGCAGATGGAGTAGGG - Intergenic
988062479 5:26190380-26190402 ATCTATCCATAGATGGGGTTGGG + Intergenic
988130746 5:27101542-27101564 ACTTTTCCACAGATGTTGTGGGG - Intronic
988390047 5:30616172-30616194 ATTTTTCCACGGATGGAGGGGGG - Intergenic
988440644 5:31228584-31228606 ATTTTTCCACAGATGTGGTGGGG + Intronic
988626143 5:32876760-32876782 ATTTTTCCGCGGATGGGGATGGG - Intergenic
988633666 5:32958178-32958200 ATTGTGCCACTGATGTGGTGAGG - Intergenic
988808161 5:34759763-34759785 ATTTTTCCACAGACCAGGTACGG - Intronic
988813599 5:34808792-34808814 ATTTTTCCATGGATGGGGGTGGG + Intronic
988850201 5:35173172-35173194 ATTATACCACAAATGGGCTGGGG - Intronic
988916630 5:35900892-35900914 ATGTATTCACAGATGGTGTGTGG - Intergenic
989472487 5:41836558-41836580 CTTTTTCCACAGATGGGGGTTGG + Intronic
989566752 5:42908894-42908916 ATTTTTCTACGGATGGAGAGGGG + Intergenic
989595929 5:43156215-43156237 ATTTTTTAACTGATGGGGTTTGG - Intronic
990468859 5:56094871-56094893 GTTTTTCCACGGACGGGGTGCGG + Intergenic
990650836 5:57897867-57897889 ATTTTTCCACGGATGGAGGTTGG + Intergenic
990972147 5:61519804-61519826 GTTTTTCCACGGATGGGGGGTGG + Intronic
991066235 5:62427759-62427781 ATTTTTCCACAGATGGGGCAGGG - Intronic
991172665 5:63646599-63646621 ATTTTTCCACAGATGGGGTGGGG + Intergenic
991625242 5:68594299-68594321 ATTTTTCCACAGATGGGGGTGGG - Intergenic
991985953 5:72287210-72287232 GTTTTTCCACAGCTGGGGGTTGG - Intronic
992109374 5:73478366-73478388 ATTTTTCCACGGACGGGTGGAGG + Intergenic
992299598 5:75364588-75364610 ATTTTTCTACAGATGGGGTGGGG + Intergenic
992428876 5:76687936-76687958 ATTTTTCCATGGACAGGGTGGGG - Intronic
992961974 5:81964958-81964980 GTTTTTCCACTGGAGGGGTGGGG + Intergenic
993077169 5:83247432-83247454 ATTTTTCCATGGACCGGGTGAGG - Intronic
993140373 5:84025574-84025596 ATTTTTCCACAGACTGGGTTGGG - Intronic
993469105 5:88285331-88285353 TTTTTTGTACAGATGGGGGGAGG - Intergenic
993770542 5:91919273-91919295 TTTTTTCCACAGACTGGGTGGGG + Intergenic
993855261 5:93066379-93066401 ATTTTTCCACAGATGGGGGTTGG - Intergenic
993913115 5:93708444-93708466 ATTTTTCCACACATGGGGAGTGG + Intronic
993954809 5:94219071-94219093 ATTTTTCCACAGATGGGGGCGGG + Intronic
994079287 5:95688427-95688449 ATTTTTATAGAGATGGGGTCTGG + Intronic
994112342 5:96020839-96020861 ATTTTTCCACAGATGGGTTGGGG - Intergenic
994163556 5:96584110-96584132 ATTTTTCCACAGACAAGGGGTGG + Intronic
994258084 5:97624330-97624352 TTTCTTCAACTGATGGGGTGGGG - Intergenic
994329462 5:98488612-98488634 ATTTTTATACAGATGGGGGTGGG + Intergenic
994708876 5:103241528-103241550 ATTTTTCCACAGATGAGGTGTGG - Intergenic
994938216 5:106284378-106284400 ATTTTTCCACGGATGGGGTAGGG + Intergenic
994952004 5:106475433-106475455 AATTTTCCACTGATGGGGTGTGG - Intergenic
995197851 5:109393620-109393642 ATTTTTTTAGAGATGGGGTCTGG - Intronic
995354429 5:111222715-111222737 TTTTTTCCACAGACAGGGGGTGG - Intergenic
995962017 5:117853286-117853308 ATTTTTCTACAGATGGGGTCAGG + Intergenic
996331179 5:122330734-122330756 ATTTTTCCATAGTTGGGGGAGGG + Intronic
996558603 5:124804258-124804280 GTTTTTCCACAGGTAGGGGGAGG - Intergenic
996808695 5:127488865-127488887 ATTTTTCCATGGATGGGGATGGG + Intergenic
997098165 5:130937408-130937430 ATTTTTCCGCAGATGAAGGGGGG - Intergenic
997169457 5:131701226-131701248 ATTTTTTCACGGATGGGGCTGGG - Intronic
997358442 5:133279405-133279427 GTTTTTCCACAGACTGGGAGTGG - Intronic
998008064 5:138670685-138670707 ATTTTTCCACAGACGGAGGGAGG + Intronic
998109042 5:139487070-139487092 ATTTTTCCATGGATGGGAAGGGG + Intergenic
998240787 5:140442405-140442427 ATTTTTCCACACGTGGGGGAGGG + Intronic
998257860 5:140602584-140602606 ATTTTTGTAGAGATGGGGTTTGG - Intergenic
998674280 5:144389660-144389682 TTTTTTCCACAGATTGGGCCAGG - Intronic
998915792 5:147010284-147010306 ATTTTTCCACAGACTGGGGCAGG + Intronic
999156082 5:149458501-149458523 CTTATTCCTTAGATGGGGTGTGG - Intergenic
999193734 5:149767811-149767833 GTTTTTCCACAGATGGGGTTGGG + Intronic
999240865 5:150126666-150126688 ATGATGCCAAAGATGGGGTGAGG - Intronic
999467618 5:151822478-151822500 ATTTAACCTCAGATGGGCTGTGG - Intergenic
999512640 5:152268708-152268730 ATTTTTCCACAGATGGTTGGGGG + Intergenic
999702360 5:154239569-154239591 ATTTTTCCACGGATGGGGACCGG - Intronic
999725711 5:154435651-154435673 ATTTTTCCACGGTTGGGGGTGGG - Intergenic
999761823 5:154707619-154707641 ATTTTTCCACAGCTGGGGTGGGG + Intergenic
1000184319 5:158844060-158844082 AGTTTCCCACAGTTGGGGTAAGG - Intronic
1000606294 5:163331119-163331141 ATTTTTGCACAGGTGGTGTTAGG + Intergenic
1000656370 5:163884137-163884159 ATTTTTCCATGGATGGGGTGAGG + Intergenic
1001350226 5:170955122-170955144 ATGTTTCCATGGATGGGGTTTGG - Intronic
1001756029 5:174170767-174170789 ATTTTTCCATAGATAGGGTGGGG + Intronic
1001842991 5:174895356-174895378 TTTTTTTCACAGATGGGAAGGGG + Intergenic
1002195643 5:177499559-177499581 ATTTTTCCACAGACTGGGGGTGG - Intergenic
1002284732 5:178154566-178154588 GCTTTTCCACAGATAGCGTGTGG + Intergenic
1002625787 5:180528008-180528030 AATTTTCCACAGATTTGGGGAGG - Intronic
1003613089 6:7630752-7630774 ATTGTTCCAAGTATGGGGTGAGG + Intergenic
1003913955 6:10768040-10768062 ATTTTTCTACAGATGGTGATAGG - Intronic
1003948456 6:11096178-11096200 ATTTTTCCACAGACGGAGCAGGG + Intronic
1004157899 6:13186758-13186780 ATTTTTCCACAGACCGGAGGTGG + Intronic
1004373756 6:15074599-15074621 ATTTTTCCACAGATGGAGGGTGG + Intergenic
1004645683 6:17558640-17558662 ACTTTTCCACAGACAGGGTGGGG - Intergenic
1004911782 6:20292744-20292766 ATTTTTCCCCAGATGGGACGGGG + Intergenic
1004949762 6:20655696-20655718 ATTTTTCCACAGACCGGGGGTGG - Intronic
1005086819 6:22015397-22015419 ATTTTTCCACGGATGGCGGTGGG - Intergenic
1005125184 6:22438822-22438844 AGTTTTTCACAGAAGGGATGAGG - Intergenic
1005283288 6:24298053-24298075 ATTTCTCCACAGACGGAGTGGGG + Intronic
1005527498 6:26665321-26665343 AATTTTCCACAGATGGTGGAGGG - Intergenic
1005532439 6:26721559-26721581 AGTTTTCTAAAAATGGGGTGGGG - Intergenic
1005535961 6:26756035-26756057 AGTTTTCTAAAAATGGGGTGGGG + Intergenic
1005538356 6:26780106-26780128 AGTTTTCTAAAAATGGGGTGGGG + Intergenic
1006237311 6:32645310-32645332 ATTTTTCCACAGATAGTTGGGGG + Intronic
1006399584 6:33809192-33809214 TTTTTTCCAAGGACGGGGTGTGG + Intergenic
1006512822 6:34530783-34530805 ATTTTTCCACGGATGGGAGCGGG + Intronic
1006680003 6:35790102-35790124 ATTTTTGTAGAGATGGGGAGGGG + Intronic
1006725997 6:36199345-36199367 ATTTTTCCACAGATGAGGGTGGG - Intronic
1007037964 6:38695508-38695530 ATATTTCCACTGCTGGGTTGGGG + Intronic
1008001515 6:46365163-46365185 ATTTTTCTACAGATGGGGTGAGG - Intronic
1008523902 6:52388443-52388465 ATTTTTCCACGTATGGGGGCTGG - Intronic
1008694139 6:54014414-54014436 ATTTTTCCACAGATGGGGCTAGG + Intronic
1009006996 6:57799694-57799716 AGTTTTCTAAAAATGGGGTGGGG + Intergenic
1009303124 6:62052588-62052610 ATTTTTCCACTGGTGGGGTGGGG + Intronic
1009526101 6:64748344-64748366 ATTTTTCCACAGACAGGGTGAGG + Intronic
1010877149 6:81120763-81120785 ACTTTTCCACAGATGGGGTGTGG - Intergenic
1011216300 6:85009481-85009503 ATTTTTCCATGGAAGGGGTGGGG + Intergenic
1011536864 6:88384949-88384971 ATTTTTGCACAGGTGGTATGTGG - Intergenic
1011569914 6:88724546-88724568 ATTTTTCCACAGACAGGGGAAGG + Intronic
1011752623 6:90468560-90468582 ATTTTTCCACATATGGGGTATGG - Intergenic
1011894170 6:92203031-92203053 ATTTTTCCACAGACCAGGTAGGG - Intergenic
1012037618 6:94162906-94162928 ATTTTTCCATGGATTGGGGGTGG + Intergenic
1012132643 6:95516858-95516880 AATTGTCCACAGATGGGTTGTGG - Intergenic
1012497883 6:99854784-99854806 TTTTTTGCAGAGATGGGGTCTGG + Intergenic
1012973439 6:105755338-105755360 ATTTTTCCATAGACTGGGGGAGG - Intergenic
1012994970 6:105964034-105964056 ATTTTCCTAGAGATGGGGGGCGG + Intergenic
1013255416 6:108380043-108380065 ATCTTTACACAGGAGGGGTGGGG + Intronic
1013333649 6:109133219-109133241 GTTTTTCCACAGATGCGGCAGGG + Intronic
1013465818 6:110416038-110416060 ATTTTTCCACAGACTGGGGATGG + Intergenic
1013535354 6:111058641-111058663 ATTTCTTTACAGATGGGGTCTGG - Intergenic
1013562021 6:111315025-111315047 ATTTTTGTAGAGATGGGGTCTGG + Intronic
1014010436 6:116469413-116469435 ATTTTTCCACAGACAGGGGTGGG + Intergenic
1014102794 6:117530285-117530307 GTTTTTCCACAGACGGGGTGGGG + Intronic
1014527590 6:122519456-122519478 ATTTTTCCACAGACGGAGGTGGG - Intronic
1014610995 6:123546373-123546395 ATTTTACCCCAGATAGTGTGGGG + Intronic
1015384079 6:132602183-132602205 ATATTTCCACAAATGAGGTGGGG + Intergenic
1015465584 6:133544779-133544801 ATTTTTCCACAGATGGGGGCGGG - Intergenic
1015508508 6:134014116-134014138 ATTTTTCCACAGACGGGGGCAGG + Intronic
1015553885 6:134440919-134440941 ATTTTTCCACAGATGGGACTGGG - Intergenic
1015819579 6:137246025-137246047 GTTTTTCCACAGATGAGGGCAGG + Intergenic
1015973861 6:138769625-138769647 ATCTTTCCATGGATGGGGCGGGG + Intronic
1015982126 6:138849842-138849864 ATTGCTTCACAGCTGGGGTGTGG - Intronic
1016123880 6:140375263-140375285 ATTTCTTGACAGATGTGGTGGGG + Intergenic
1016663007 6:146602884-146602906 ATTTTTCCATGGATGGAGAGGGG - Intronic
1016845023 6:148561249-148561271 ATTTTTCCGTAGATGGGGTGGGG - Intergenic
1017097299 6:150815929-150815951 ATTTTTCCACGGATGGAGGCAGG + Intronic
1017207546 6:151819772-151819794 ATTTTTCCACAGATGGAACTGGG - Intronic
1017260106 6:152376021-152376043 ATTTTTCCACAGATGGGGTGGGG + Intronic
1017318229 6:153057583-153057605 ATTTTTCCACGGATGGGTGTGGG + Intronic
1017804360 6:157930721-157930743 ATTTTTCCACAGATAGACAGTGG - Intronic
1018856432 6:167678584-167678606 TTTATTCCAACGATGGGGTGAGG + Intergenic
1019887942 7:3921786-3921808 ATTTTTATAGAGATGGGGTCTGG - Intronic
1020066037 7:5189437-5189459 TTTTTTGTAGAGATGGGGTGGGG - Intergenic
1020089141 7:5328348-5328370 ATTTTCGTGCAGATGGGGTGGGG - Intronic
1020151693 7:5686778-5686800 ATTTTTCCACGGACAGGGCGTGG + Intronic
1020952035 7:14691733-14691755 TTCTTTACAGAGATGGGGTGGGG + Intronic
1021000508 7:15324652-15324674 ATTTTCCCACAGATGGTGGGGGG + Intronic
1021560282 7:21962522-21962544 ATTTTTCCACGGATGGGTTGAGG + Intergenic
1021656807 7:22881183-22881205 ATTTGTCCAGTGCTGGGGTGTGG - Intergenic
1021711479 7:23420286-23420308 ATTTTTGTAGAGATGGGGTTTGG - Intronic
1023199700 7:37682992-37683014 ATTTTTCCACAGACAGGGGTGGG - Intergenic
1023282727 7:38588129-38588151 CTTTTTCTAGAGATGGGGTTTGG + Intronic
1023325901 7:39055847-39055869 ATTTTTTCTGGGATGGGGTGAGG + Intronic
1023349748 7:39308795-39308817 ATGTTTCCTGGGATGGGGTGGGG - Intronic
1023469354 7:40497560-40497582 ATTAATCCACTGATGGTGTGGGG - Intronic
1023601350 7:41884582-41884604 AGTTTTCCACTGATTGGATGAGG - Intergenic
1023728770 7:43170358-43170380 ATTTTTCCACAGACAGGGGTGGG - Intronic
1024204332 7:47143232-47143254 ATTTTGCCACAGAATGGGAGTGG + Intergenic
1024650838 7:51402125-51402147 ATTTTTCCACAGACTGGGAGTGG + Intergenic
1024883789 7:54118428-54118450 ATTATTGTAGAGATGGGGTGGGG - Intergenic
1025054959 7:55757705-55757727 ATTTTTCCACAGACTGGGAGTGG + Intergenic
1025104907 7:56162808-56162830 ATTTTTCCACGGATGGGGGTTGG - Intergenic
1025133030 7:56387927-56387949 ATTTTTCCACAGACTGGGAGTGG + Intergenic
1025205171 7:56988793-56988815 ATTTTCATGCAGATGGGGTGGGG + Intergenic
1025666767 7:63588141-63588163 ATTTTCATGCAGATGGGGTGGGG - Intergenic
1025956229 7:66185272-66185294 TTTTTTTAAGAGATGGGGTGGGG + Intergenic
1025978794 7:66391017-66391039 TTTTTTCCACAGACTGGGGGTGG + Intronic
1026137839 7:67679113-67679135 ACTTTGCCACAGATGAGCTGCGG + Intergenic
1026149563 7:67776416-67776438 ATTTTTCCAAGGATGGGGTTGGG + Intergenic
1026182346 7:68052964-68052986 ATTTTTCCATTGATGGGTGGGGG + Intergenic
1026314053 7:69212477-69212499 ATTTTTCCACAGATAAGGGGTGG - Intergenic
1027389808 7:77693630-77693652 ATATTTAGACAGATGGTGTGTGG + Intergenic
1027426639 7:78068091-78068113 ATTTTTCCATAGACCAGGTGGGG + Intronic
1027747000 7:82088832-82088854 ATTTTTCCACAAATGGAGGTGGG + Intronic
1028057198 7:86261173-86261195 ATTTTTCCACGGACGGGGAAGGG + Intergenic
1028078460 7:86544577-86544599 ACTTTACCACAGATGAGGTCTGG - Intergenic
1028297148 7:89148002-89148024 ATTTTTCCACAGACAGGGCAAGG - Intronic
1028348672 7:89816428-89816450 ATTTTTCCACAGATGGGGGCAGG + Intergenic
1028479812 7:91292460-91292482 ATTTTTCCACAGATTGGGGTAGG - Intergenic
1028815568 7:95140143-95140165 ATTTTTCCACTGTAGGGGAGTGG + Intronic
1029450082 7:100636499-100636521 AGTATTCCAGAGATGGAGTGCGG - Intronic
1030323279 7:108192483-108192505 GTTTTTCCACGGACAGGGTGGGG - Intronic
1030479263 7:110081879-110081901 ATTTTTCCATGGATGGGGGCAGG + Intergenic
1030515380 7:110532266-110532288 ATTACTACACAGTTGGGGTGGGG - Intergenic
1030613824 7:111717145-111717167 ATTTTTCCATAGACAGGGTAGGG - Intergenic
1030759984 7:113338516-113338538 ATTTTGCCAGAGCTGGGGTAAGG - Intergenic
1030948805 7:115763330-115763352 ATTTTTCCACGGAAGGGGAGTGG + Intergenic
1031169685 7:118277039-118277061 ATTTTTCCACAGAGGAGGTGGGG - Intergenic
1031221820 7:118976319-118976341 ATTTTTCCACGGACGGGGAGGGG + Intergenic
1031840305 7:126729407-126729429 ATTTTTCCACCCAAGGGGTAAGG - Intronic
1032058528 7:128704207-128704229 GTCTTTCCACAGATGGAGGGTGG + Intergenic
1032073395 7:128823833-128823855 ATTTTTCCACAGATGGAGAGGGG + Intergenic
1032219595 7:129983971-129983993 ATCTTTCTAGAGATGGGGTTTGG - Intergenic
1032795579 7:135273574-135273596 ATTTTTCCACAGACTGGTTGGGG + Intergenic
1032878818 7:136066842-136066864 ATTTTTCCACGCACGGGGTCAGG + Intergenic
1033024223 7:137757203-137757225 ATTTTTCCTGAAGTGGGGTGGGG - Intronic
1033097173 7:138441898-138441920 ACTTCTTCTCAGATGGGGTGTGG + Intergenic
1033167885 7:139057176-139057198 ATGTTTCTAGAGATGGGGAGGGG - Intronic
1033360160 7:140633339-140633361 ATTTTTATAGAGATGGGGTTTGG + Intronic
1033853102 7:145521962-145521984 ATTTTTCCACAGATGGGTTGTGG - Intergenic
1034158634 7:148976112-148976134 ATTTCTAATCAGATGGGGTGGGG + Intergenic
1034905436 7:154940647-154940669 ATTTTCCCATAGATTGGGTAGGG - Intronic
1035774094 8:2173959-2173981 ATTTTTCCACGGACGGGGTGAGG + Intergenic
1036119881 8:6004332-6004354 ATTTTCCCACAGACAGGGTCGGG - Intergenic
1036132707 8:6131276-6131298 ATTTTTCCACGGATGAGGACGGG + Intergenic
1036459840 8:8942333-8942355 AGTTTTCCAGAAAAGGGGTGAGG + Intergenic
1036578596 8:10052378-10052400 TTTTTTCCACAGATGGGGAAGGG - Intergenic
1037233708 8:16691142-16691164 AGTTTTCCAGGAATGGGGTGTGG - Intergenic
1037376705 8:18238167-18238189 ATTTTTCCATGGATGGGGTTAGG + Intergenic
1037496265 8:19443866-19443888 ATTTTTCCACACTGGGGGTGGGG + Intronic
1037539228 8:19855511-19855533 ATCATTCCTCAGGTGGGGTGGGG + Intergenic
1037603585 8:20419311-20419333 GTTTTTCCATGGATGGGGGGTGG + Intergenic
1037742525 8:21618959-21618981 GTTTTTCCACAGATGGGGTGAGG - Intergenic
1038032973 8:23661091-23661113 ATTTTTCCACAGATGGTGGGGGG + Intergenic
1038117752 8:24576814-24576836 ATTTTTCATCACATGGGTTGAGG - Intergenic
1038136989 8:24796969-24796991 ATGTTTGCAGAGATGGAGTGTGG - Intergenic
1038195055 8:25359727-25359749 ATTTTTCCACGGATGGGGGCAGG - Intronic
1038514898 8:28179494-28179516 ATTTTTCCACAGATAGTAAGGGG + Intronic
1038607659 8:29024969-29024991 ATTTTTCCACCGACGGGGTGGGG - Intronic
1039187328 8:34931822-34931844 ATTTTTCTACAGAAGGGGCGGGG + Intergenic
1039594453 8:38778749-38778771 ACTTTTTCCCAGATGGGGAGAGG + Intronic
1039604030 8:38866226-38866248 ATTTTTCCACGGATCAGGGGAGG + Intergenic
1039665913 8:39527916-39527938 AGTATTCAACAGATGGGATGAGG - Intergenic
1039730618 8:40272417-40272439 TTTTTTCCACAGGGTGGGTGGGG - Intergenic
1041281569 8:56215427-56215449 ATTTTTCCACGGATGGGGAAGGG + Intronic
1041483130 8:58345150-58345172 AATTTTCCACAGATGGGGTGGGG + Intergenic
1041835661 8:62210428-62210450 ATTTTTCCACAGAGTGGGGATGG - Intergenic
1041860217 8:62504227-62504249 ATTTTTCCACAGACTGGTGGTGG - Intronic
1041913581 8:63116101-63116123 TTTTTTGTACAGATGGGGTCTGG + Intergenic
1042378250 8:68081127-68081149 ATTTTTCCACAGGCGGAGGGTGG + Intronic
1042910842 8:73824599-73824621 ATTTTTCCATGGATGGGGTTGGG + Intronic
1043005579 8:74814352-74814374 ATTTTTCCACAGACGAGGGAGGG + Intronic
1043445228 8:80313046-80313068 ATGTTTCCACAAATGGGGTGGGG + Intergenic
1044064953 8:87687945-87687967 CCTTTTCCACAGATGGGGGTTGG + Intergenic
1044206503 8:89497067-89497089 ATTTTTTTACAGATGGGGAAAGG - Intergenic
1044519042 8:93176551-93176573 ATTTTTCCATGGATGGGGTGGGG - Intergenic
1044784951 8:95783700-95783722 GTTTTTCCATGGATGGGGTGTGG - Intergenic
1045038843 8:98201394-98201416 ATTTTTTTAGAGATGGGGTCCGG + Intronic
1045041596 8:98229553-98229575 ATTTTTGCAGAGATAGGGTCTGG + Intronic
1045132763 8:99175579-99175601 ATTTTTCTAGAAATGGGGTCTGG - Intronic
1045229783 8:100292963-100292985 ATTTTTCCACAGATGGAGGTGGG + Intronic
1045877531 8:106999736-106999758 ATTTTTCCACAGACAGGGTGGGG - Intergenic
1045900401 8:107272286-107272308 ATTTTTCATCATTTGGGGTGAGG - Intronic
1045946715 8:107804881-107804903 GTTTTTCCACAGATGGGGTGGGG + Intergenic
1046013092 8:108573973-108573995 ATTTCTCCACGGTTGGAGTGGGG + Intergenic
1046062682 8:109157974-109157996 ATTTTTCTACAGATGGTGAGGGG + Intergenic
1046349335 8:112985975-112985997 GTTTTTCCACAGATCGGGGGTGG - Intronic
1046857736 8:119053127-119053149 ATTTTTCCACTGAAGTGTTGAGG - Intronic
1047131399 8:122024309-122024331 ATTTCTTCACAGATGAGATGAGG - Intergenic
1047340716 8:123977741-123977763 ATTTTTCCATGAATGGGTTGGGG + Intronic
1047559921 8:125975791-125975813 CTTTCTCCACAGATGGGGATGGG + Intergenic
1048562808 8:135560036-135560058 ATTTTTGCAGAGATGGGGTCTGG - Intronic
1048583441 8:135750138-135750160 ATTTTTCCACAGATGGTGGAAGG - Intergenic
1049255767 8:141612844-141612866 ATTTTTCCACGGACGGGGTAGGG + Intergenic
1050127632 9:2375836-2375858 AGTTTTCCACAGATGGTGGGTGG + Intergenic
1050173502 9:2846569-2846591 ATTTTTGTAGAGATGGGGTTTGG - Intergenic
1050244883 9:3678375-3678397 ATATTTTCAGAGATGGGGGGAGG + Intergenic
1050301102 9:4259715-4259737 CTCTATTCACAGATGGGGTGGGG + Intronic
1050431652 9:5568503-5568525 ATTTTTCCATGGATTGGGTGTGG - Intronic
1050486886 9:6143722-6143744 ATTTTTCCACAGACCGGTTGGGG + Intergenic
1050712050 9:8476157-8476179 ATTTTTCCACGGACAGGGTGGGG + Intronic
1050908878 9:11040762-11040784 ATTTTTCCATGGAGGGGATGTGG - Intergenic
1051010222 9:12403431-12403453 AATTTTCCACTGATGTTGTGGGG + Intergenic
1051332124 9:16033691-16033713 GTTTTTCCACAGACAGGGGGTGG - Intronic
1051378608 9:16431727-16431749 ATTTTTCCACAGATGTGAGTAGG + Intronic
1051602704 9:18890726-18890748 ATTTTTCAGGAGCTGGGGTGGGG - Intronic
1051766974 9:20535312-20535334 AATTTTCCATGGATGGGGTGGGG - Intronic
1052189490 9:25642079-25642101 ATTTTTCCACAAATGGGGGATGG + Intergenic
1052349178 9:27440906-27440928 ATTTTTCCACAGCAGGGTTAGGG + Intronic
1052811403 9:33063794-33063816 ATTTTTCCACAGATGGTGGTGGG - Intronic
1052835436 9:33246610-33246632 ATGTGTTCACAGATGGGCTGTGG - Exonic
1053728555 9:41028635-41028657 ATTTTTCCACAGACTCGGGGAGG + Intergenic
1054699946 9:68403445-68403467 ATTTTTCCACAGACTGGGGGAGG - Intronic
1055354957 9:75428295-75428317 ATTTTTCCACAGACTGGGAGGGG - Intergenic
1055409979 9:76018577-76018599 ATTTTTCCACGGATGTGGGGTGG - Intronic
1055602148 9:77931064-77931086 ATTTTTCCAGGGATGGGGGTCGG - Intronic
1056350744 9:85746234-85746256 AGATGTCCACAGAGGGGGTGAGG - Intergenic
1056706451 9:88956088-88956110 ATTTTTCCACGGAGGGTGCGTGG + Intergenic
1057167165 9:92938053-92938075 GTTTTTCCATGGATGGGGAGGGG - Intergenic
1057396840 9:94688316-94688338 ATTTTTGTAGAGATGGGGTCTGG - Intergenic
1057447456 9:95127398-95127420 ATGTTTCCACAGACCGGGAGGGG + Intronic
1057597134 9:96424087-96424109 ACCTTTCCACAGATGGAGAGAGG - Intergenic
1057984771 9:99702001-99702023 GTTTTTCCATGGATGGGGCGGGG + Intergenic
1058167225 9:101633745-101633767 ATTTTTTCATGGATGGGTTGGGG - Intronic
1058824988 9:108767312-108767334 TTTTTTCCACTGATGGGCAGGGG - Intergenic
1058891129 9:109361704-109361726 TTTTTTGTAGAGATGGGGTGTGG - Intergenic
1060333950 9:122704153-122704175 TTTTTTCCACGGATGGTGGGAGG - Intergenic
1060345958 9:122815998-122816020 ATTTTTCCACAGACTGGGGTTGG + Intronic
1060605568 9:124910897-124910919 GTTTTTCCACAGATGGGGTCAGG - Intronic
1060676210 9:125517375-125517397 ATTTTTCCAGGGTTGGGGTGGGG + Intronic
1060874382 9:127070067-127070089 GTTTTTCCACGGATGGAGAGTGG + Intronic
1060902754 9:127275308-127275330 ATCTTTCCCCACATGGGCTGTGG + Intronic
1061467589 9:130794143-130794165 ATTTTTCCACAGACTGGGGATGG - Intronic
1061581177 9:131537431-131537453 ACTTTTCCACAGACTGGGTAGGG + Intergenic
1061844220 9:133377730-133377752 ATTTTTCCACAGATGGAGGCGGG + Intronic
1061976617 9:134071202-134071224 ATTTTTCCACGGATGAGTGGGGG + Intergenic
1062217378 9:135396590-135396612 ATTTTTCCATGGACAGGGTGAGG - Intergenic
1185728139 X:2439480-2439502 ATTTTTCCACTGATGTGGGGTGG + Intronic
1186023185 X:5279890-5279912 AGTTTTCAACAGATTGAGTGAGG - Intergenic
1186050215 X:5584474-5584496 ATTTTTCCACAGACAGGGGTGGG + Intergenic
1186112204 X:6270401-6270423 ATATTTCCACGGATGTGGGGTGG + Intergenic
1186221712 X:7356169-7356191 ATTTTTCCACAAACTGGGGGTGG - Intergenic
1186394175 X:9191352-9191374 ATTTTTCCATGAATGGGGTGGGG - Intergenic
1186996709 X:15131400-15131422 TTTTTTCCACAGACGGGGGGTGG - Intergenic
1187013874 X:15307368-15307390 ATTTTTCCACAGATGAGGGTGGG + Intronic
1187276374 X:17819608-17819630 AGTATTCCACAGTTTGGGTGTGG - Intronic
1187386251 X:18851368-18851390 ATTTTTCCACAGACTGGGGTCGG - Intergenic
1187557743 X:20368214-20368236 ATTTTTCCACAGACCAGGGGTGG - Intergenic
1187860592 X:23678755-23678777 TTTTTTGTAGAGATGGGGTGTGG - Intronic
1187909121 X:24094082-24094104 ATTTTTTCACAGATAGGGGGTGG - Intergenic
1187927113 X:24260620-24260642 ATTTTTAAAGAGATGGGGTCTGG + Intergenic
1188283932 X:28305112-28305134 GTTTTTCCACAGATGTGGGAAGG + Intergenic
1188313516 X:28646116-28646138 ATTTTTCCATGGACGGGGTCTGG + Intronic
1189114848 X:38331757-38331779 ATTTTTGTAGAGATGGGGTTTGG + Intronic
1189382623 X:40512752-40512774 GCTTTTCCACAGACGGGGTTGGG - Intergenic
1189587573 X:42476606-42476628 ATTTTTCCACAAACAGGGGGAGG - Intergenic
1189596449 X:42571323-42571345 CTTTTTCGAGAGATGGGTTGAGG - Intergenic
1189609707 X:42719094-42719116 ATTTTTCCATGGATGGGGTGGGG - Intergenic
1190868394 X:54404348-54404370 ATTTTTGTAGAGATGGGGTCTGG - Intergenic
1190887990 X:54546030-54546052 ATTTTTGTAGAGATGGGGGGAGG + Intronic
1190951561 X:55150285-55150307 ATTTTTCCACAGATGGGGGAAGG + Intronic
1192156313 X:68749171-68749193 ATTTTTCCACAGATGAGGCCTGG - Intergenic
1192407523 X:70901485-70901507 ATTTTTCCACGGATGGTGGGGGG + Intronic
1193324410 X:80162594-80162616 ATTTCTCCACAGATGGAGTGGGG - Intergenic
1193976960 X:88132711-88132733 TTTTTTCCACGGAGGGGGTAGGG - Intergenic
1194548274 X:95265453-95265475 ATATTTTCAAAAATGGGGTGGGG - Intergenic
1194649058 X:96493159-96493181 ATTTTTCCATTGATGGGGTGAGG - Intergenic
1194786223 X:98087311-98087333 ATTTTTCCACAAATGGTTGGGGG + Intergenic
1195124306 X:101790289-101790311 ATTTTTCCACCGATGGGGTGTGG - Intergenic
1195398337 X:104435177-104435199 TTTTTTCCCCAAGTGGGGTGAGG + Intergenic
1195639980 X:107162801-107162823 ATTTTTCCACAGATGGCGGGAGG + Intronic
1195768866 X:108327326-108327348 ATTTTTCCATAGAAGGGGCCGGG - Intronic
1196150619 X:112369404-112369426 AGTCTTCCACAGATGGCCTGGGG - Intergenic
1197008182 X:121529375-121529397 ATTTTTCTACAGATGGGGGCAGG - Intergenic
1197808840 X:130423155-130423177 ATTTTTCCACAAATGGGGGTGGG - Intergenic
1197840874 X:130745037-130745059 ATTTTTCCACAGACTGAGTCGGG - Intronic
1198045557 X:132898181-132898203 ATTTTTCCACGGACAGGGGGAGG - Intronic
1198065068 X:133088276-133088298 AATTTTCCACAGACCGGGGGTGG + Intronic
1198270898 X:135055377-135055399 ATTTTTCCATGGATGGGGCTGGG + Intergenic
1198271297 X:135058766-135058788 ATTTTTCCAAGGATGGGGGTTGG - Intergenic
1198710385 X:139495363-139495385 ATTTTCTTACAGATGGGGTGTGG - Intergenic
1198744101 X:139871818-139871840 ATTTTTAAACAGGTCGGGTGAGG - Intronic
1198761482 X:140037459-140037481 GTCTTTCCACAGATTGGATGAGG - Intergenic
1199088330 X:143660065-143660087 ATCTGTCCAGAGCTGGGGTGGGG + Intergenic
1199529338 X:148829528-148829550 ATTCTCCCAGGGATGGGGTGGGG - Intronic
1199706217 X:150427764-150427786 ATTTTTCCTCTGATTTGGTGAGG + Intronic
1200254182 X:154570664-154570686 AGTTTTCCACAGACGGGGATGGG + Intergenic
1200263587 X:154633744-154633766 AGTTTTCCACAGACGGGGATGGG - Intergenic
1200825297 Y:7632245-7632267 ATTTTTCCACAGATCATGGGTGG + Intergenic
1201241862 Y:11965119-11965141 ATTTTTCCACAGACAGGGTTGGG + Intergenic
1201326472 Y:12765687-12765709 ATTTTTCCACAGACTGGGTGGGG - Intronic
1201361299 Y:13152805-13152827 AGTTTTCCAGAGATTGGGGGGGG + Intergenic
1201693194 Y:16792484-16792506 ATTTTTCCACAAATGAGCTGGGG - Intergenic
1202093396 Y:21217566-21217588 ATTTTTACAGAGAAGGGGAGAGG + Intergenic
1202193157 Y:22265806-22265828 ATTTTTCCACAGATCATGAGTGG + Intergenic
1202202602 Y:22369112-22369134 ATTTTTCCACAGATAATGGGTGG - Intronic
1202234759 Y:22698841-22698863 ATTTTTCCACAGATCATGGGTGG - Intergenic
1202297178 Y:23371871-23371893 ATTTTTCCACAGACTGGTGGAGG + Intergenic
1202308400 Y:23497327-23497349 ATTTTTCCACAGATCATGGGTGG + Intergenic
1202562401 Y:26173259-26173281 ATTTTTCCACAGATCATGGGTGG - Intergenic
1202573629 Y:26298726-26298748 ATTTTTCCACAGACTGGTGGAGG - Intergenic
1202603459 Y:26618244-26618266 ATTTTTCCATGGACGGGGTGGGG + Intergenic