ID: 1094523408

View in Genome Browser
Species Human (GRCh38)
Location 12:31216166-31216188
Sequence CAGAAGCAGCAGCAGCAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094523408_1094523412 7 Left 1094523408 12:31216166-31216188 CCTCACTGCTGCTGCTGCTTCTG No data
Right 1094523412 12:31216196-31216218 GTGTGAGCTGCTGCTGCTGGTGG No data
1094523408_1094523411 4 Left 1094523408 12:31216166-31216188 CCTCACTGCTGCTGCTGCTTCTG No data
Right 1094523411 12:31216193-31216215 CATGTGTGAGCTGCTGCTGCTGG No data
1094523408_1094523413 22 Left 1094523408 12:31216166-31216188 CCTCACTGCTGCTGCTGCTTCTG No data
Right 1094523413 12:31216211-31216233 GCTGGTGGCATGTGTGAATGAGG No data
1094523408_1094523414 25 Left 1094523408 12:31216166-31216188 CCTCACTGCTGCTGCTGCTTCTG No data
Right 1094523414 12:31216214-31216236 GGTGGCATGTGTGAATGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094523408 Original CRISPR CAGAAGCAGCAGCAGCAGTG AGG (reversed) Intergenic
No off target data available for this crispr