ID: 1094524216

View in Genome Browser
Species Human (GRCh38)
Location 12:31220929-31220951
Sequence TCCAAGCGTTGGACATGAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094524207_1094524216 27 Left 1094524207 12:31220879-31220901 CCTCATCTTGATGAGGAAACAGT No data
Right 1094524216 12:31220929-31220951 TCCAAGCGTTGGACATGAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094524216 Original CRISPR TCCAAGCGTTGGACATGAGG CGG Intergenic
No off target data available for this crispr