ID: 1094524326

View in Genome Browser
Species Human (GRCh38)
Location 12:31221696-31221718
Sequence GGTCTTCTTCCCGGGACCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094524326_1094524331 2 Left 1094524326 12:31221696-31221718 CCTGAGGTCCCGGGAAGAAGACC No data
Right 1094524331 12:31221721-31221743 GCCTCATTTCAGGTTGCTTGCGG No data
1094524326_1094524329 -8 Left 1094524326 12:31221696-31221718 CCTGAGGTCCCGGGAAGAAGACC No data
Right 1094524329 12:31221711-31221733 AGAAGACCAAGCCTCATTTCAGG No data
1094524326_1094524333 13 Left 1094524326 12:31221696-31221718 CCTGAGGTCCCGGGAAGAAGACC No data
Right 1094524333 12:31221732-31221754 GGTTGCTTGCGGCCAAAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094524326 Original CRISPR GGTCTTCTTCCCGGGACCTC AGG (reversed) Intergenic
No off target data available for this crispr