ID: 1094524333

View in Genome Browser
Species Human (GRCh38)
Location 12:31221732-31221754
Sequence GGTTGCTTGCGGCCAAAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094524323_1094524333 28 Left 1094524323 12:31221681-31221703 CCTCAAGAGGCACAGCCTGAGGT No data
Right 1094524333 12:31221732-31221754 GGTTGCTTGCGGCCAAAGACAGG No data
1094524326_1094524333 13 Left 1094524326 12:31221696-31221718 CCTGAGGTCCCGGGAAGAAGACC No data
Right 1094524333 12:31221732-31221754 GGTTGCTTGCGGCCAAAGACAGG No data
1094524328_1094524333 4 Left 1094524328 12:31221705-31221727 CCGGGAAGAAGACCAAGCCTCAT No data
Right 1094524333 12:31221732-31221754 GGTTGCTTGCGGCCAAAGACAGG No data
1094524330_1094524333 -8 Left 1094524330 12:31221717-31221739 CCAAGCCTCATTTCAGGTTGCTT No data
Right 1094524333 12:31221732-31221754 GGTTGCTTGCGGCCAAAGACAGG No data
1094524327_1094524333 5 Left 1094524327 12:31221704-31221726 CCCGGGAAGAAGACCAAGCCTCA No data
Right 1094524333 12:31221732-31221754 GGTTGCTTGCGGCCAAAGACAGG No data
1094524321_1094524333 29 Left 1094524321 12:31221680-31221702 CCCTCAAGAGGCACAGCCTGAGG No data
Right 1094524333 12:31221732-31221754 GGTTGCTTGCGGCCAAAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094524333 Original CRISPR GGTTGCTTGCGGCCAAAGAC AGG Intergenic
No off target data available for this crispr