ID: 1094526071

View in Genome Browser
Species Human (GRCh38)
Location 12:31232101-31232123
Sequence GAGGAAAAGCCAGGATCTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094526071_1094526075 -9 Left 1094526071 12:31232101-31232123 CCCAAAGATCCTGGCTTTTCCTC No data
Right 1094526075 12:31232115-31232137 CTTTTCCTCCCCAGGAGACCAGG No data
1094526071_1094526084 28 Left 1094526071 12:31232101-31232123 CCCAAAGATCCTGGCTTTTCCTC No data
Right 1094526084 12:31232152-31232174 CCCCATACACTGAAGGCAGCAGG No data
1094526071_1094526082 21 Left 1094526071 12:31232101-31232123 CCCAAAGATCCTGGCTTTTCCTC No data
Right 1094526082 12:31232145-31232167 TCAGCATCCCCATACACTGAAGG No data
1094526071_1094526076 -8 Left 1094526071 12:31232101-31232123 CCCAAAGATCCTGGCTTTTCCTC No data
Right 1094526076 12:31232116-31232138 TTTTCCTCCCCAGGAGACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094526071 Original CRISPR GAGGAAAAGCCAGGATCTTT GGG (reversed) Intergenic
No off target data available for this crispr