ID: 1094526079

View in Genome Browser
Species Human (GRCh38)
Location 12:31232124-31232146
Sequence GAGCTTATCCCTGGTCTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094526079_1094526087 12 Left 1094526079 12:31232124-31232146 CCCAGGAGACCAGGGATAAGCTC No data
Right 1094526087 12:31232159-31232181 CACTGAAGGCAGCAGGAAGCTGG No data
1094526079_1094526082 -2 Left 1094526079 12:31232124-31232146 CCCAGGAGACCAGGGATAAGCTC No data
Right 1094526082 12:31232145-31232167 TCAGCATCCCCATACACTGAAGG No data
1094526079_1094526084 5 Left 1094526079 12:31232124-31232146 CCCAGGAGACCAGGGATAAGCTC No data
Right 1094526084 12:31232152-31232174 CCCCATACACTGAAGGCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094526079 Original CRISPR GAGCTTATCCCTGGTCTCCT GGG (reversed) Intergenic
No off target data available for this crispr