ID: 1094526081

View in Genome Browser
Species Human (GRCh38)
Location 12:31232133-31232155
Sequence GGGGATGCTGAGCTTATCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094526081_1094526084 -4 Left 1094526081 12:31232133-31232155 CCAGGGATAAGCTCAGCATCCCC No data
Right 1094526084 12:31232152-31232174 CCCCATACACTGAAGGCAGCAGG No data
1094526081_1094526087 3 Left 1094526081 12:31232133-31232155 CCAGGGATAAGCTCAGCATCCCC No data
Right 1094526087 12:31232159-31232181 CACTGAAGGCAGCAGGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094526081 Original CRISPR GGGGATGCTGAGCTTATCCC TGG (reversed) Intergenic
No off target data available for this crispr