ID: 1094526082

View in Genome Browser
Species Human (GRCh38)
Location 12:31232145-31232167
Sequence TCAGCATCCCCATACACTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094526079_1094526082 -2 Left 1094526079 12:31232124-31232146 CCCAGGAGACCAGGGATAAGCTC No data
Right 1094526082 12:31232145-31232167 TCAGCATCCCCATACACTGAAGG No data
1094526078_1094526082 -1 Left 1094526078 12:31232123-31232145 CCCCAGGAGACCAGGGATAAGCT No data
Right 1094526082 12:31232145-31232167 TCAGCATCCCCATACACTGAAGG No data
1094526077_1094526082 2 Left 1094526077 12:31232120-31232142 CCTCCCCAGGAGACCAGGGATAA No data
Right 1094526082 12:31232145-31232167 TCAGCATCCCCATACACTGAAGG No data
1094526074_1094526082 12 Left 1094526074 12:31232110-31232132 CCTGGCTTTTCCTCCCCAGGAGA No data
Right 1094526082 12:31232145-31232167 TCAGCATCCCCATACACTGAAGG No data
1094526071_1094526082 21 Left 1094526071 12:31232101-31232123 CCCAAAGATCCTGGCTTTTCCTC No data
Right 1094526082 12:31232145-31232167 TCAGCATCCCCATACACTGAAGG No data
1094526080_1094526082 -3 Left 1094526080 12:31232125-31232147 CCAGGAGACCAGGGATAAGCTCA No data
Right 1094526082 12:31232145-31232167 TCAGCATCCCCATACACTGAAGG No data
1094526072_1094526082 20 Left 1094526072 12:31232102-31232124 CCAAAGATCCTGGCTTTTCCTCC No data
Right 1094526082 12:31232145-31232167 TCAGCATCCCCATACACTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094526082 Original CRISPR TCAGCATCCCCATACACTGA AGG Intergenic
No off target data available for this crispr