ID: 1094526084

View in Genome Browser
Species Human (GRCh38)
Location 12:31232152-31232174
Sequence CCCCATACACTGAAGGCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094526074_1094526084 19 Left 1094526074 12:31232110-31232132 CCTGGCTTTTCCTCCCCAGGAGA No data
Right 1094526084 12:31232152-31232174 CCCCATACACTGAAGGCAGCAGG No data
1094526080_1094526084 4 Left 1094526080 12:31232125-31232147 CCAGGAGACCAGGGATAAGCTCA No data
Right 1094526084 12:31232152-31232174 CCCCATACACTGAAGGCAGCAGG No data
1094526072_1094526084 27 Left 1094526072 12:31232102-31232124 CCAAAGATCCTGGCTTTTCCTCC No data
Right 1094526084 12:31232152-31232174 CCCCATACACTGAAGGCAGCAGG No data
1094526081_1094526084 -4 Left 1094526081 12:31232133-31232155 CCAGGGATAAGCTCAGCATCCCC No data
Right 1094526084 12:31232152-31232174 CCCCATACACTGAAGGCAGCAGG No data
1094526079_1094526084 5 Left 1094526079 12:31232124-31232146 CCCAGGAGACCAGGGATAAGCTC No data
Right 1094526084 12:31232152-31232174 CCCCATACACTGAAGGCAGCAGG No data
1094526078_1094526084 6 Left 1094526078 12:31232123-31232145 CCCCAGGAGACCAGGGATAAGCT No data
Right 1094526084 12:31232152-31232174 CCCCATACACTGAAGGCAGCAGG No data
1094526071_1094526084 28 Left 1094526071 12:31232101-31232123 CCCAAAGATCCTGGCTTTTCCTC No data
Right 1094526084 12:31232152-31232174 CCCCATACACTGAAGGCAGCAGG No data
1094526077_1094526084 9 Left 1094526077 12:31232120-31232142 CCTCCCCAGGAGACCAGGGATAA No data
Right 1094526084 12:31232152-31232174 CCCCATACACTGAAGGCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094526084 Original CRISPR CCCCATACACTGAAGGCAGC AGG Intergenic
No off target data available for this crispr