ID: 1094529834

View in Genome Browser
Species Human (GRCh38)
Location 12:31263860-31263882
Sequence AGCAAAAGTTCTTAGTGTAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094529834_1094529836 -8 Left 1094529834 12:31263860-31263882 CCCGTACACTAAGAACTTTTGCT No data
Right 1094529836 12:31263875-31263897 CTTTTGCTCTGTGACTAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094529834 Original CRISPR AGCAAAAGTTCTTAGTGTAC GGG (reversed) Intergenic
No off target data available for this crispr