ID: 1094530073

View in Genome Browser
Species Human (GRCh38)
Location 12:31266012-31266034
Sequence CCATTAGCACCTTTGGAACG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094530073_1094530077 10 Left 1094530073 12:31266012-31266034 CCTCGTTCCAAAGGTGCTAATGG No data
Right 1094530077 12:31266045-31266067 CTGCTGACTGCGCTCCTTAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094530073 Original CRISPR CCATTAGCACCTTTGGAACG AGG (reversed) Intergenic
No off target data available for this crispr