ID: 1094530077

View in Genome Browser
Species Human (GRCh38)
Location 12:31266045-31266067
Sequence CTGCTGACTGCGCTCCTTAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094530071_1094530077 22 Left 1094530071 12:31266000-31266022 CCGAAGGTGAGACCTCGTTCCAA No data
Right 1094530077 12:31266045-31266067 CTGCTGACTGCGCTCCTTAACGG No data
1094530070_1094530077 25 Left 1094530070 12:31265997-31266019 CCTCCGAAGGTGAGACCTCGTTC No data
Right 1094530077 12:31266045-31266067 CTGCTGACTGCGCTCCTTAACGG No data
1094530073_1094530077 10 Left 1094530073 12:31266012-31266034 CCTCGTTCCAAAGGTGCTAATGG No data
Right 1094530077 12:31266045-31266067 CTGCTGACTGCGCTCCTTAACGG No data
1094530075_1094530077 3 Left 1094530075 12:31266019-31266041 CCAAAGGTGCTAATGGCTGAAGG No data
Right 1094530077 12:31266045-31266067 CTGCTGACTGCGCTCCTTAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094530077 Original CRISPR CTGCTGACTGCGCTCCTTAA CGG Intergenic
No off target data available for this crispr