ID: 1094534245

View in Genome Browser
Species Human (GRCh38)
Location 12:31306943-31306965
Sequence GAAGGTGGTAAGGTTAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 207}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094534245 Original CRISPR GAAGGTGGTAAGGTTAAAGC AGG (reversed) Intronic
900018927 1:173039-173061 GTAGGGGTTGAGGTTAAAGCAGG - Intergenic
900049183 1:531634-531656 GTAGGGGTTTAGGTTAAAGCAGG - Intergenic
902949032 1:19866644-19866666 GTAGGTGGTGATGTTAGAGCTGG + Intergenic
904910427 1:33930554-33930576 GCAGGTGGTAGGGAGAAAGCTGG - Intronic
910391104 1:86745496-86745518 GACTGTGGGAAGGTTAAACCTGG - Intronic
910589294 1:88912273-88912295 GAAGGTGGGAAGGTGGAAGTAGG - Intergenic
910702696 1:90093269-90093291 GATTGTGGTAAGGTCTAAGCAGG + Intergenic
912842831 1:113053722-113053744 GAAGGGGGAAAGGATATAGCAGG + Intergenic
913319583 1:117578912-117578934 GGAGGTGGGAGGGTTAAACCAGG - Intergenic
915078746 1:153336578-153336600 AAAGGTGGGAAGGTGAGAGCAGG + Intronic
915196593 1:154194318-154194340 GAAGGTGAGAAGGGTTAAGCTGG - Intronic
916290995 1:163166000-163166022 TGAGGTAGTAAGGTTGAAGCTGG + Intronic
918689553 1:187464293-187464315 GAAGGTGGGAGGGTTAGAGGAGG - Intergenic
920144703 1:203849287-203849309 TAACATGGTAAAGTTAAAGCAGG - Intronic
921756463 1:218862497-218862519 GAAGGGGGTAAGGTTCAAAAGGG + Intergenic
922426107 1:225496211-225496233 GAAACTGGTAAGGTTAAAATAGG - Exonic
922450588 1:225734185-225734207 GGAGGTGATAAGGATAATGCAGG + Intergenic
923588078 1:235293675-235293697 GAAGGTGGAAAGATGAAAGCAGG + Intronic
924348960 1:243096473-243096495 GTAGGGGTTGAGGTTAAAGCAGG - Intergenic
924861287 1:247925162-247925184 GAACGTGGTAAGGTCAAATGTGG + Intergenic
1062956888 10:1546413-1546435 GCAGGTGGTAATTTTAGAGCTGG - Intronic
1064399098 10:15005947-15005969 GAAGGTGGAAAGTATAAAGGTGG - Intergenic
1066727407 10:38408430-38408452 GTAGGGGTTGAGGTTAAAGCAGG + Intergenic
1069119896 10:64556625-64556647 GAAGATGGTAATGTTGGAGCTGG - Intergenic
1070251783 10:74779599-74779621 GAAGGTGGGAAGCCCAAAGCTGG + Intergenic
1071016173 10:80999224-80999246 GAAGGTGGAACAGTTAAAACTGG - Intergenic
1072569808 10:96648643-96648665 GTATGTGGTAAGGTCAAGGCAGG - Exonic
1075026900 10:118991937-118991959 CAAGGTGGTCAGGATACAGCGGG + Intergenic
1075659236 10:124181972-124181994 GAAGGTGGTGGGGAGAAAGCAGG - Intergenic
1075820265 10:125301976-125301998 GAAGGAATTAAGGTTAAAGGAGG + Intergenic
1076281142 10:129247315-129247337 GAAGGTGGTGACGGGAAAGCTGG - Intergenic
1081219356 11:40440725-40440747 GAAGGTGGAGAGAATAAAGCTGG - Intronic
1084226770 11:67720558-67720580 GAAGGTGGAAAGTATAAAGGTGG - Intergenic
1084845524 11:71896305-71896327 GAAGGTGGAAAGTATAAAGATGG + Intronic
1087701840 11:101443873-101443895 CAAGGTGGTTATGTTACAGCAGG + Intergenic
1088128423 11:106457840-106457862 GAAGGTGCAAAGGTGAAAGCTGG - Intergenic
1088918352 11:114243847-114243869 GAAGGTGGCATGGTCAGAGCAGG - Intronic
1090410833 11:126508534-126508556 GATGGTGGAAGGGTTCAAGCAGG + Intronic
1092191446 12:6524205-6524227 GAAGGTGGTAGGACTTAAGCTGG + Intronic
1092503150 12:9066901-9066923 GAAGTAGGAAAGGTTAAAGCAGG - Intergenic
1094003930 12:25727141-25727163 GAAGGTGGGAGGGTTGAAACTGG + Intergenic
1094534245 12:31306943-31306965 GAAGGTGGTAAGGTTAAAGCAGG - Intronic
1095349669 12:41193718-41193740 AAGGGTGATAAGGTTAAAGAAGG - Intronic
1095350556 12:41205573-41205595 GAAGTTAGTGAGGTTAAAGGAGG - Intronic
1096896954 12:54830647-54830669 GAAGGTGGTAGAGTTAAAAGGGG - Intronic
1097347376 12:58508681-58508703 AAAAGGAGTAAGGTTAAAGCGGG + Intergenic
1099705040 12:86141570-86141592 GAAAGTGTTCAGTTTAAAGCTGG - Intronic
1101219774 12:102626367-102626389 GAAGGTGGGAAGGATAAAGGGGG + Intergenic
1101233521 12:102765806-102765828 GTAGGGGGTAGGGTCAAAGCAGG + Intergenic
1101769296 12:107733688-107733710 GCAGCTAGTAAGTTTAAAGCAGG - Exonic
1102371868 12:112388499-112388521 GAAGATGTTGAGTTTAAAGCTGG + Intergenic
1102514460 12:113437026-113437048 GAAGGGGGTGAGGATAAAGAAGG + Intronic
1104575912 12:129965758-129965780 GAAGGTGGTAAAGGTGAAGGTGG - Intergenic
1106667884 13:31871605-31871627 CAAGGTGGTAGGGATACAGCTGG + Intergenic
1107031495 13:35858465-35858487 GAAGATGGCAGAGTTAAAGCTGG + Intronic
1108730331 13:53228787-53228809 AAAGGTGGTAAGGGTAGAACTGG + Intergenic
1109001502 13:56811325-56811347 GCAGGTGGTAAGGCAAAACCAGG - Intergenic
1109839644 13:67905095-67905117 GAAGGTGGAAAGTATAAAGGTGG + Intergenic
1110103510 13:71639901-71639923 AAAGGTAGTAATGTTAAAGGTGG - Intronic
1110136487 13:72073645-72073667 TAAGGAGGTAAGGTTAAATTAGG + Intergenic
1111507276 13:89208659-89208681 AAAGGTGGGAAGCTCAAAGCAGG - Intergenic
1113859767 13:113473700-113473722 GAGGGTGGTAACGTTACAGCTGG + Intronic
1116955298 14:50917072-50917094 GAAGGAGCTAAGATTGAAGCAGG - Exonic
1117039847 14:51759860-51759882 GAAGGTGGAAAGTATAAAGGTGG + Intergenic
1117041099 14:51769868-51769890 GAAGGTGGAAAGTATAAAGGTGG - Intergenic
1118608709 14:67522846-67522868 GAAGGTGGCAGGGTTCTAGCAGG - Intronic
1119829370 14:77687471-77687493 GAAGGAGGTGAGGTATAAGCAGG - Intronic
1119877813 14:78075341-78075363 TAAGGTGGTCAGGAAAAAGCTGG - Intergenic
1120391678 14:83916456-83916478 TAAGATGGTAAGGCTAAAGTAGG + Intergenic
1121912493 14:97804050-97804072 GAAGGTGTTCAGGTAAAGGCTGG + Intergenic
1123707453 15:22960266-22960288 GAAGCTGGTGAGGTTGATGCTGG - Intronic
1126896006 15:53257937-53257959 GATGCTGGTACTGTTAAAGCTGG + Intergenic
1127892687 15:63269247-63269269 GAAGGAGGTAAGGATGAAGGTGG - Intergenic
1131641358 15:94297585-94297607 GAAGTTGACATGGTTAAAGCAGG + Intronic
1131871720 15:96770835-96770857 CAAGGTGGTCAGGGTACAGCTGG - Intergenic
1133711666 16:8407520-8407542 AAAGGAGGAAAGGTAAAAGCAGG - Intergenic
1138236780 16:55390246-55390268 GAAGCTGGGAAAGTTGAAGCTGG - Intronic
1141982283 16:87557921-87557943 GGAGATGGGAAGGTTAGAGCTGG + Intergenic
1142444732 16:90129424-90129446 GTAGGGGTTGAGGTTAAAGCAGG + Intergenic
1142462778 17:106042-106064 GTAGGGGTTGAGGTTAAAGCAGG - Intergenic
1144793493 17:17875290-17875312 GAAGGTGAGAAGGTGAAAGGAGG + Intronic
1145897374 17:28467249-28467271 GGAGGTGGTAAGATTAATGCTGG - Intronic
1147377133 17:40029155-40029177 GCAGGTGGTAAGGTTGGAGTGGG + Intronic
1156948686 18:42866959-42866981 GAAGGTGTTAAACTTAAAGCAGG - Intronic
1157576808 18:48749131-48749153 CAAGGTGGTAAGATTAAAACAGG + Intronic
1157731498 18:50008218-50008240 GAAGGTAGGATGGTTAAAGGTGG - Intronic
1157732570 18:50016928-50016950 GAAGGGGGTAGGGTTAAATTTGG - Intronic
1161437338 19:4271597-4271619 GAAGGTGGTGAAAATAAAGCAGG + Intergenic
1161750742 19:6094585-6094607 AAAGGTGTTAAAGTCAAAGCAGG - Intronic
1166099197 19:40560941-40560963 GAAGGTTTTAGGGATAAAGCCGG + Intronic
1166874001 19:45886271-45886293 GAAGGTTGTAAGGTTTGCGCCGG - Intergenic
1168335699 19:55596428-55596450 GAAGGAGGTAAGGTGAAAGATGG - Intronic
926041840 2:9679780-9679802 GGAGGTGGAAAGGTGAGAGCTGG - Intergenic
927113814 2:19883049-19883071 GAAGGTGGTAAGGTTCAAAAAGG - Intergenic
928926398 2:36584155-36584177 GAAGGTGGGATGGTGAAGGCTGG + Intronic
932094928 2:68839174-68839196 GCAGGAGGGAAGTTTAAAGCTGG - Intergenic
935920662 2:108009802-108009824 GAAGGTGGTTAGTTTAAGGATGG + Intronic
936159055 2:110070485-110070507 GAAGGGGGTAGGGTTTAAGCAGG - Intergenic
936185606 2:110300847-110300869 GAAGGGGGTAGGGTTTAAGCAGG + Intergenic
940870536 2:158856459-158856481 GAAGGTGGAAAGTCTAAAGGTGG + Intronic
942338003 2:174911826-174911848 CAAGGTTGTAAGGTTTAAGTAGG - Intronic
942679811 2:178465422-178465444 CATGCTGGTAAGGTTAAAGTTGG + Exonic
946234720 2:218316892-218316914 GAAGGTTGGTAGGTTAAGGCTGG + Intronic
946262745 2:218508877-218508899 TAATGTTGTAAGTTTAAAGCTGG + Intronic
1168919468 20:1518980-1519002 GATGGTGCTTTGGTTAAAGCAGG - Intergenic
1169752296 20:9006840-9006862 GGTTGTGGGAAGGTTAAAGCAGG - Intergenic
1171447192 20:25213236-25213258 GAACGTGGTAAGAGCAAAGCAGG - Intronic
1174418680 20:50385161-50385183 GAGGGTGCTGAGGTCAAAGCAGG - Intergenic
1175263691 20:57690114-57690136 GCAGGTGGGAAGGTTAGATCTGG - Intronic
1175717821 20:61267063-61267085 GAAGGTGGGAAGGTCAAGGAAGG + Intronic
1177703762 21:24674061-24674083 TAAGGAGATAAGGTTAAAGGCGG - Intergenic
1179654050 21:42834238-42834260 GAAAGTGGTCAGGTCATAGCGGG + Intergenic
1182551309 22:31102269-31102291 GAAGATGGTTAGGTCAGAGCTGG + Intronic
1185258408 22:49849014-49849036 GAGGGTGGTAAGGTGAAACCTGG + Intergenic
949159999 3:870092-870114 CAAGGTGGTAAGGTTACTGTGGG + Intergenic
949866154 3:8549192-8549214 GAAGTTGGTGAGGTACAAGCTGG + Intronic
949885606 3:8691046-8691068 GAAGGTGGAAAGTATAAAGGTGG + Intronic
950094804 3:10322539-10322561 GGTGGTGGTTAGGTTAGAGCAGG + Intergenic
950592912 3:13951792-13951814 AAAGGTGGGAAGGCCAAAGCTGG - Intronic
952314702 3:32222430-32222452 TAAGGAGGAAAGGTTAAAGGAGG - Intergenic
954064143 3:48092401-48092423 GAAGGGGTTTAGGTTAAAACTGG - Intergenic
954366637 3:50149992-50150014 GAAAGTGGTAAGGGTGAAGGGGG - Intergenic
954414491 3:50386493-50386515 GAAGTTGCTAAAATTAAAGCTGG - Intronic
956774130 3:72550810-72550832 GAAGGAGGGAAGGGAAAAGCAGG - Intergenic
957043387 3:75354601-75354623 GAAGGTGGAAAGTATAAAGGTGG - Intergenic
957075166 3:75596753-75596775 GAAGGTGGAAAGTATAAAGGTGG - Intergenic
959975482 3:112454163-112454185 GAAAGTGGCAAAGATAAAGCTGG + Intergenic
960364700 3:116757112-116757134 GCTGGTGGTAAGGTTAAAGCTGG - Intronic
960594397 3:119395065-119395087 TAAGGTGGTAAGTTTAAGGGTGG + Intronic
961276019 3:125727392-125727414 GAAGGTGGAAAGTATAAAGGTGG + Intergenic
961703886 3:128768789-128768811 TAAGGTGGAAAGGCTGAAGCTGG - Intronic
962917173 3:139915009-139915031 AAAGGGGGTAAGGCTAATGCAGG - Intergenic
964776248 3:160281410-160281432 GAGGGTGGAAATGTTACAGCAGG + Intronic
966230702 3:177648511-177648533 GGAGGTGGTAAGGTTAACATTGG + Intergenic
967044305 3:185722550-185722572 GAAGGTGGGAAGGTGGAAACAGG + Intronic
967092700 3:186148875-186148897 GAAAGTGGTAAGGAAAAAGAAGG - Exonic
968400296 4:289343-289365 GAAACTGGTAAGGTTAAAATAGG + Intronic
968418941 4:466296-466318 GAAACTGGTAAGGTTAAAATGGG + Intronic
968987816 4:3887406-3887428 GAAGGTGGAAAGTATAAAGGTGG - Intergenic
969730355 4:8952492-8952514 GAAGGTGGAAAGTATAAAGGTGG + Intergenic
969786528 4:9462122-9462144 GAAGGTGGAAAGTATAAAGGTGG + Intergenic
969789956 4:9486604-9486626 GAAGGTGGAAAGTATAAAGGTGG + Intergenic
970587414 4:17527894-17527916 GAAGGAAGCAAGGTTAAAGAAGG + Intergenic
971359146 4:25921111-25921133 GAAGGTGGAAAAGTCAAATCTGG + Intronic
975994853 4:80302512-80302534 GAAGTTGATTAGATTAAAGCTGG - Intronic
976557813 4:86468988-86469010 GAAAGTGGGAATGTTAAATCTGG + Intronic
979425168 4:120554833-120554855 GGTGGTGGTCAGGTTAAAGGGGG + Intergenic
980696044 4:136356758-136356780 GAAAGAGGTAAAGTTAAAGATGG + Intergenic
981976318 4:150733492-150733514 GAAAGTTGTAAGAATAAAGCAGG - Intronic
983567251 4:169166337-169166359 GCTGGTGGTAAGGTGAAAACGGG + Intronic
986974437 5:13379252-13379274 GAAGGTGGGCAGGTGAAAGAGGG - Intergenic
987852113 5:23369395-23369417 GAAGGGAGCAAGGTTAAAGTAGG - Intergenic
988089556 5:26519190-26519212 GAAGGTGGCAAGCTGAATGCAGG + Intergenic
990537788 5:56740128-56740150 GAATGTTTTAAGGCTAAAGCTGG + Intergenic
992943651 5:81788495-81788517 GGAGGTGGTAAGGGTGAAGTGGG - Intergenic
995045082 5:107636812-107636834 GAAGGTGATAAGGTTCTGGCAGG + Intronic
995390395 5:111634433-111634455 GAAAGTGGTAGAGTTAAAGAGGG - Intergenic
996819020 5:127605208-127605230 GAAGATGTAAAGGTCAAAGCCGG - Intergenic
997302609 5:132816988-132817010 GAAGGTGGGAAGGTCACATCAGG - Intergenic
998467894 5:142360494-142360516 GAAGGTGATAAGTTTAATACTGG + Intergenic
999161907 5:149508079-149508101 GAGAGTGGTAAAGTTAAAGGAGG + Intronic
999387964 5:151168975-151168997 GAAGGTGGTGAGGCTTAAACTGG - Intergenic
999628084 5:153541180-153541202 GAAGGAGGTAATGTTTGAGCTGG - Intronic
999793795 5:154968809-154968831 GAAAGTGGTAAGGAAAAAGTAGG + Exonic
999866969 5:155711351-155711373 GAAGGAAGTCAAGTTAAAGCAGG - Intergenic
1002833304 6:843762-843784 TAAGGAGGTAAGGTTAAATGAGG - Intergenic
1002907995 6:1466548-1466570 CAAGGTGGTCAGGTTACAGCTGG + Intergenic
1004238339 6:13895718-13895740 GAAGCTGGAAAGGGTAAAGAAGG - Intergenic
1004417309 6:15436628-15436650 GAAGGTGGGGAGGGAAAAGCTGG - Intronic
1005353367 6:24959060-24959082 GAAGTTTGTAAGATCAAAGCTGG - Intronic
1005595789 6:27377857-27377879 GAAGGTTGTGAACTTAAAGCAGG - Intronic
1005767431 6:29026755-29026777 GTAGATGGGAAGGTTAAGGCTGG + Intergenic
1006944043 6:37772407-37772429 AAAGGTGATAAGGTGAAAGTCGG + Intergenic
1012399768 6:98834110-98834132 GGAGGGGGTAAGGGAAAAGCTGG - Intergenic
1013899956 6:115143248-115143270 GATTGTGGTAAGGTTTAACCAGG - Intergenic
1014298694 6:119652808-119652830 GAAGGAGGTAAGGTTAAATGAGG + Intergenic
1017561594 6:155634004-155634026 TAAGATGGCAAGGTCAAAGCAGG - Intergenic
1018694177 6:166377826-166377848 GAAGCTGGAAATGTTGAAGCAGG - Intronic
1022220538 7:28309523-28309545 GAAGCTGGTGAGGGTTAAGCAGG - Intronic
1023685999 7:42736421-42736443 GAAGGTGTTAAGGTCAGAGAAGG + Intergenic
1024069480 7:45774368-45774390 GTAGGGGTTGAGGTTAAAGCAGG + Intergenic
1025252306 7:57359805-57359827 GAGGGTGCTGAGGTCAAAGCAGG + Intergenic
1025834827 7:65084955-65084977 GTAGGGGGTGAGGTTAACGCAGG + Intergenic
1025904599 7:65774434-65774456 GTAGGGGGTGAGGTTAACGCAGG + Intergenic
1031404402 7:121367312-121367334 TAAGATGGTTAGTTTAAAGCAGG + Intronic
1032046873 7:128618672-128618694 GTAGGGGTTGAGGTTAAAGCAGG + Intergenic
1032495849 7:132361623-132361645 GAAGGAGGAAAGGTTAGAGCAGG + Intronic
1035332555 7:158105777-158105799 GATGGAGATAAGGATAAAGCAGG - Intronic
1036261539 8:7244702-7244724 GAAGGTGGAAAGTATAAAGGTGG - Intergenic
1036279332 8:7386282-7386304 AAAGGTGGGAAGGGTAAAGAGGG - Intergenic
1036305057 8:7594854-7594876 GAAGGTGGAAAGTATAAAGGTGG + Intergenic
1036313579 8:7703246-7703268 GAAGGTGGAAAGTATAAAGGTGG - Intergenic
1036342182 8:7925590-7925612 AAAGGTGGGAAGGGTAAAGAGGG + Intergenic
1036355908 8:8042850-8042872 GAAGGTGGAAAGTATAAAGGTGG + Intergenic
1036842429 8:12134675-12134697 GAACGTGGAAAGGTTATCGCTGG - Intergenic
1036863712 8:12376178-12376200 GAACGTGGAAAGGTTATCGCTGG - Intergenic
1037143235 8:15542071-15542093 CAAGGTGGTCAGGGTACAGCTGG + Intronic
1038589907 8:28827401-28827423 GAAGGTGGTAAGTAAAAAACTGG + Intronic
1040621057 8:49093232-49093254 CAAGGTGGTCAGGGTACAGCTGG - Intergenic
1040707516 8:50147315-50147337 GAAGGTGGTAAGGGAAAAATTGG + Intronic
1042799844 8:72706843-72706865 GACTGTGGGTAGGTTAAAGCAGG - Intronic
1043624081 8:82232959-82232981 CAAGGTGGTCAGGGTACAGCTGG - Intergenic
1044426404 8:92056140-92056162 GAAGGTGGTGAAGTTAAATGAGG + Intronic
1047767875 8:128004085-128004107 GAGGTTGGTAAGGTTAAACGAGG - Intergenic
1048060149 8:130910451-130910473 GAAGGAGGTAAGGCTGAGGCAGG - Intronic
1048086717 8:131188946-131188968 GTAGGTGCTAAGGTTACAGAGGG - Intergenic
1048335958 8:133502361-133502383 GAAGGTAATAAGGTTAAATGAGG + Intronic
1048534810 8:135283365-135283387 CAAGGTGGACAGGTTAGAGCTGG + Intergenic
1050601891 9:7261366-7261388 GAAGGAGGTAAGGTGAGAGAAGG - Intergenic
1051213919 9:14776055-14776077 GAAGGAGGTCAGGGGAAAGCAGG + Exonic
1051991342 9:23155904-23155926 GAAGATGAAAAGGTTGAAGCAGG - Intergenic
1054762256 9:69013837-69013859 GAAGGTGGTGAAGATGAAGCAGG - Exonic
1056863614 9:90210127-90210149 GAAGGTGGAAAGTATAAAGGTGG + Intergenic
1056916295 9:90749320-90749342 GAAGGTGGAAAGTATAAAGGTGG - Intergenic
1057579290 9:96271897-96271919 GAGAGGGGTAAGGTAAAAGCAGG + Intronic
1057659082 9:96984044-96984066 GAAGGTGGAAGGGCAAAAGCGGG + Intronic
1059237062 9:112770060-112770082 GAAGGTGGGAAGGTGGAAGCAGG - Intronic
1062749718 9:138244421-138244443 GTAGGGGTTGAGGTTAAAGCAGG + Intergenic
1189233881 X:39473036-39473058 GAAGGTGGTAGTGTTAGAGAAGG - Intergenic
1190475762 X:50825848-50825870 GAAGGGGAAAAAGTTAAAGCTGG - Intergenic
1191137540 X:57082381-57082403 GAAGCTGGGAAGGAGAAAGCTGG + Intergenic
1193210217 X:78798530-78798552 GAATGTGGTAAGGGTAAAAATGG + Intergenic
1195051257 X:101098856-101098878 GAAGGGGGAAAGGTTAGAGAGGG - Intronic
1197723264 X:129759253-129759275 GAAGGTGGTGAGGGGAAATCTGG - Intronic
1198686235 X:139230687-139230709 GAAGATGGGGAGGTTAATGCTGG + Intergenic
1201335035 Y:12871584-12871606 CAAGGTGGTAAGATGAAGGCTGG - Intergenic