ID: 1094541085

View in Genome Browser
Species Human (GRCh38)
Location 12:31363775-31363797
Sequence AGGGCTCTTTCTCACTTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 154}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094541085 Original CRISPR AGGGCTCTTTCTCACTTGGA TGG (reversed) Intergenic
901532735 1:9863712-9863734 AGGGCACATGCTGACTTGGAAGG + Intronic
902139996 1:14345299-14345321 AGGGCTTGTTCACACCTGGATGG + Intergenic
907546761 1:55267247-55267269 AAGGCTATTTCTCCATTGGATGG + Intergenic
908770357 1:67590477-67590499 AGGGCTATTTTTAGCTTGGAAGG - Intergenic
910813561 1:91263986-91264008 ACAGCTTTGTCTCACTTGGATGG + Intronic
915212294 1:154319400-154319422 AGGCATCTTTCTGACTTGAAGGG + Intergenic
917389224 1:174515422-174515444 AGGGCTTGTTCCCACTTGGCAGG + Intronic
919780581 1:201218362-201218384 AGTGCTCTTTCCACCTTGGAGGG + Intronic
922712539 1:227844746-227844768 AGGGCTCCTCCTCATTTGGTGGG + Intronic
923307729 1:232703530-232703552 AAGGTTCTTTCTCACATGGAAGG - Intergenic
924552604 1:245092393-245092415 AGGGTACTTTCTTACATGGAAGG - Intronic
1065167212 10:22992151-22992173 AAGGCTCTGTGTCACTTGGGAGG + Intronic
1067061097 10:43078274-43078296 AGGGCTCCTTCCCTCTTAGAGGG - Intronic
1067295588 10:44973608-44973630 AGGGCTCCTTAAAACTTGGACGG - Intronic
1069123950 10:64605960-64605982 AGGGCTCATTCACACTCTGAAGG + Intergenic
1069796310 10:71053859-71053881 AGGTCCCTTTCTCACTGGAATGG + Intergenic
1070153131 10:73817595-73817617 AGGGCTCTCTGTAACTTGGGAGG - Intronic
1070827932 10:79401944-79401966 GGGGCTCTTGCTCTCTGGGAAGG - Intronic
1072172293 10:92876958-92876980 AGGGCTCTCTCTTACTAGAAGGG + Intronic
1073514598 10:104065225-104065247 AGGGCACTTTCTGACCTGCATGG - Intronic
1075514881 10:123100812-123100834 AGGGCTCTTTCTCTCTCGAGGGG - Intergenic
1078143467 11:8707836-8707858 GGGGCCCTTTCCCACTTGGCTGG + Exonic
1078517354 11:12034126-12034148 CTGGCTCTTTCTCACTTGTGTGG - Intergenic
1079449780 11:20589781-20589803 AGGACTCTTTTTCAATTGCAAGG - Intergenic
1080726575 11:34904254-34904276 AGGGCCCATTGTCACTTTGAAGG - Intronic
1082026581 11:47576994-47577016 ATGGCTATATCTCACTTGCAAGG + Intronic
1084504884 11:69559338-69559360 AGGGCTCTTTCTCCAGTGAAGGG - Intergenic
1084738201 11:71119648-71119670 AGGGCCCTCTCTCACTTGCATGG + Intronic
1089589491 11:119531386-119531408 AGGGCTCCTGCTCCCCTGGAGGG - Intergenic
1092181809 12:6451448-6451470 AGGTCTCACTCTCCCTTGGATGG - Exonic
1094541085 12:31363775-31363797 AGGGCTCTTTCTCACTTGGATGG - Intergenic
1096783348 12:54003444-54003466 TGGGCTCCTTCTACCTTGGAAGG + Intronic
1097942407 12:65325776-65325798 AGGCCTCTTTCCCACTGTGATGG + Intronic
1098743031 12:74199759-74199781 ATGGGTCTTTCTCACATGAATGG + Intergenic
1099927546 12:89036222-89036244 AGGGCTCTTTCTGATTTGCACGG + Intergenic
1099947491 12:89261206-89261228 GTGGTTCTTTCTCACTTTGAAGG - Intergenic
1102817129 12:115875607-115875629 AGTGCACATTCTCACCTGGAGGG - Intergenic
1105014425 12:132777452-132777474 GGGGCGCTTTCTCTCTTGGGGGG + Intronic
1110179609 13:72599624-72599646 AGGCCCCTTTCTCACTGGGTAGG - Intergenic
1113167136 13:107454425-107454447 GGGGCTCTTTCCCACTTTGTTGG - Intronic
1114227540 14:20752763-20752785 GGGCATCTTTCCCACTTGGAAGG + Intergenic
1114554627 14:23554845-23554867 AGGGAGCTTCCTCACATGGAAGG + Intronic
1115931651 14:38503493-38503515 AGGGCCCATTATCCCTTGGAGGG + Intergenic
1116644767 14:47512744-47512766 ATGGCTTTTTCTCACTGTGAGGG + Intronic
1118707456 14:68493382-68493404 AGGGCTGTTTTTTTCTTGGAGGG - Intronic
1118860359 14:69658280-69658302 TGAGCTCTGTCTCACCTGGATGG - Intronic
1119877198 14:78071067-78071089 GAGGTTCTTTCTCACTGGGAGGG - Intergenic
1125174944 15:36810367-36810389 TGGGTTCTTTCTCACTTTTAAGG - Intergenic
1128055660 15:64698117-64698139 GGGGCCCTTTCTCAGATGGAAGG - Intronic
1131894011 15:97006358-97006380 AGGGCTTTTTCTTGCTTTGATGG - Intergenic
1132829126 16:1918875-1918897 CGGCCTCTTTCTCCCTTGGCAGG - Intergenic
1133357707 16:5148596-5148618 AGTGCTCTTCCTCCCTGGGACGG + Intergenic
1134275568 16:12772991-12773013 ACAGCCCTTTGTCACTTGGAAGG + Intronic
1134771461 16:16812838-16812860 ATGGCTTTTTCACACATGGAGGG + Intergenic
1138861586 16:60764403-60764425 AGGACCCTTTCTTACATGGATGG - Intergenic
1140038645 16:71390493-71390515 AGGGCCTATTCTCACGTGGATGG + Intergenic
1141757054 16:85998237-85998259 AGGGCTCTTGCGCACATGAAAGG + Intergenic
1141837474 16:86551895-86551917 AGGGCACTTTCTGTATTGGAGGG + Intronic
1142790804 17:2264144-2264166 AGGTCTCATTCTTATTTGGAAGG + Intronic
1143764180 17:9126896-9126918 TGGGCTCATTTTCACTTCGAGGG + Intronic
1143850515 17:9808215-9808237 AGGGTTCTTTCTCCCTGGAAAGG + Intronic
1144278437 17:13699648-13699670 AGGGCTTTTTCTCACTTTGTGGG + Intergenic
1144335132 17:14261822-14261844 AGGCCTCTTTCTCACTGTGACGG + Intergenic
1146898551 17:36564671-36564693 AAGGCTCCCTCTCCCTTGGATGG + Intronic
1147062240 17:37889786-37889808 AGAGCTCATTCTCACTTCAAAGG + Intergenic
1147865748 17:43551028-43551050 AGGACTCTTTTTCCCTTGGGTGG + Intronic
1156765056 18:40642922-40642944 AGGTCTTTTTCTCACGTAGAGGG - Intergenic
1157173317 18:45428007-45428029 TGAACTCTTTCTTACTTGGATGG - Intronic
1160060053 18:75521689-75521711 TGGGCACTTTCACACTTCGATGG + Intergenic
1163014927 19:14448896-14448918 AAGGCTCTTTCTCCCTGTGAGGG - Intronic
1163284766 19:16339428-16339450 CGGGCTCTATCTCAAATGGATGG + Intergenic
1164434627 19:28218851-28218873 AGGGCTCTTTGTCAGCAGGAGGG + Intergenic
927207147 2:20617948-20617970 ACGGCTCCTTCTCCCTGGGAAGG + Exonic
929121920 2:38490469-38490491 AGGCCTCATTCTCTCATGGAGGG + Intergenic
929560415 2:42953043-42953065 ATGGCTGTTTCTCAGTAGGAGGG - Intergenic
931241219 2:60453966-60453988 TGGTCTCTTTCCCATTTGGAAGG + Intronic
934158895 2:89229639-89229661 AGGGCTCTTTCTCAGTTGCCTGG - Intergenic
934208379 2:89952789-89952811 AGGGCTCTTTCTCAGTTGCCTGG + Intergenic
935234252 2:101124905-101124927 AGGGCTCTGACTCACTTGGTGGG - Intronic
940017562 2:149122734-149122756 AGGGCGGTTTCTCACTTTGGGGG + Intronic
944005344 2:194897694-194897716 AGGAATCTTTCTCACTAGGTTGG + Intergenic
944874471 2:203948025-203948047 AGGTTTGTTGCTCACTTGGATGG + Intronic
946144587 2:217719496-217719518 AGGGCACTTTCTGACTGGGGAGG + Intronic
948966333 2:241383530-241383552 AGGGCTTCTGCTCACATGGAGGG + Intronic
1169171914 20:3471687-3471709 TGGGGTCTTTCTCTGTTGGAAGG + Intronic
1172365829 20:34348393-34348415 ATGGCTGTTTCTCACTTGCTTGG + Intergenic
1172586656 20:36090077-36090099 GGGGCACTTGCTCATTTGGAAGG + Intergenic
1173482838 20:43416703-43416725 AGGGTTGTTTCTCAGTTGCAGGG - Intergenic
1173577541 20:44122929-44122951 AGGGCATTTTCTCAGTTTGAAGG - Intronic
1173837961 20:46138188-46138210 AAGGCTATTTGTCACTTGGCTGG - Intergenic
1174397736 20:50258405-50258427 TGGGCCCTTTCTCACTCGGGAGG + Intergenic
1174856176 20:54047524-54047546 AGGGCTCTTGCTCACTCCCAAGG + Intronic
1174861855 20:54098756-54098778 AGGGATCCTTCTCACAGGGAAGG - Intergenic
1182863049 22:33577665-33577687 AGGGCTCTTTAGCACTTTGTAGG + Intronic
1185005764 22:48275880-48275902 AGGGCTGGTTCTCCCTGGGAAGG + Intergenic
1185179250 22:49349824-49349846 AGGGCTCTTGCTGCCTGGGAGGG + Intergenic
949500846 3:4678762-4678784 AGGGCCCGTTCTCAGGTGGATGG + Intronic
950098740 3:10344873-10344895 GGGGATCTTGCTCACTGGGAAGG - Intronic
952848586 3:37709586-37709608 AGGGCTCTTCCTCCCTTGGTTGG + Intronic
952978184 3:38713965-38713987 CGGGCTCTTTCTCGATTTGAAGG - Exonic
953354715 3:42245845-42245867 AGGGATCATTTTCACTTGGATGG - Intergenic
953613657 3:44469902-44469924 AGGACTCTTTCGCTCTTGTAAGG + Intronic
955106488 3:55903770-55903792 AGGCCACTTTCTCACTGGCATGG + Intronic
955543119 3:59999171-59999193 AGGGCTCTCTCTCCCAGGGAGGG - Intronic
956029878 3:65026029-65026051 ACGGCTCTTTCTCACTGTCATGG - Intergenic
957110658 3:75952259-75952281 AGAGCTCATTCTGACTTGGGAGG + Intronic
961291173 3:125848204-125848226 AGTGCTCTTCCTCCCTGGGACGG - Intergenic
963544605 3:146640544-146640566 AGGGCTATTTGCCATTTGGATGG + Intergenic
967143401 3:186583947-186583969 ATGGATATTACTCACTTGGATGG + Exonic
968076999 3:195821496-195821518 CGGGCTCCTGCTCACCTGGAGGG - Intergenic
968291199 3:197541106-197541128 AGGGCTGCTTCTCAATTTGAAGG + Intronic
970298163 4:14653620-14653642 AGGGCACTTAGTCACTTGCAAGG + Intergenic
971745551 4:30575036-30575058 TGGGTTCCTTCTCACTTAGAGGG + Intergenic
971751648 4:30657148-30657170 GCGTCACTTTCTCACTTGGATGG - Intergenic
976393453 4:84530341-84530363 AGGGCTCTTGCTGACAGGGAGGG + Intergenic
979046962 4:115879359-115879381 AGGGCTTTTTCTAACTCTGAAGG + Intergenic
979596453 4:122540251-122540273 TGGGCTCTGACTCACTTAGAAGG - Intergenic
984881413 4:184412965-184412987 AGGGCTCTCTGTCACTTCAAAGG + Intronic
986072358 5:4297685-4297707 AAGGCTTTTTGTCGCTTGGATGG - Intergenic
986812430 5:11374134-11374156 AGGACTGTCTCTCACTTGAAGGG - Intronic
986892820 5:12329940-12329962 AGTATTCTTTCCCACTTGGATGG - Intergenic
987669975 5:20994130-20994152 AGGGCTTTTTGTCACTGGCAAGG - Intergenic
988599082 5:32622794-32622816 TGGGCCCTTTCTCACTTGTTGGG - Intergenic
993535573 5:89081582-89081604 ATGGCTCTTTTTCACCTGGCTGG - Intergenic
994809923 5:104502812-104502834 ATGTTTCTTTCTCACATGGAAGG + Intergenic
995054504 5:107744561-107744583 AAAGGTCTTTCTCACTTGCATGG + Intergenic
998513012 5:142729292-142729314 TGAGCTCTTTCTGCCTTGGAAGG - Intergenic
1002851537 6:1001146-1001168 AGGACTGTGTCTCACCTGGAAGG + Intergenic
1002974719 6:2062901-2062923 ACAGCTCTTTCTCACTTGTAAGG + Intronic
1006220358 6:32484429-32484451 GGGGCTCCTTCTCGCCTGGATGG - Intergenic
1006520434 6:34568218-34568240 AGGGTTCTTTCTCACGTGCCTGG + Intergenic
1006910289 6:37559038-37559060 CTGGCTCTTTCTCATCTGGAAGG + Intergenic
1008279138 6:49574648-49574670 AAGGCTGTTTGCCACTTGGAAGG + Intergenic
1011956589 6:93031551-93031573 ATAGCTCTTTCTCACTTTGTAGG - Intergenic
1012109764 6:95214671-95214693 AATGGTCTTACTCACTTGGATGG + Intergenic
1014198736 6:118586024-118586046 AGGGCCCATTGTCACTTTGAAGG - Intronic
1015544493 6:134347652-134347674 CGGGCTCTGTTTCATTTGGAAGG + Intergenic
1015856671 6:137632379-137632401 TTGACTCTTTCTCACTTGGCCGG - Intergenic
1017053882 6:150420493-150420515 AGGGCTCTCTCTCTGTTGAATGG - Intergenic
1018242146 6:161788113-161788135 AGAGTTCTCTCTCACATGGATGG + Intronic
1020616831 7:10469069-10469091 AGGCCTGTTTCTCACCTGAATGG + Intergenic
1021792207 7:24217114-24217136 AGGCCTCCTTATCACTTTGAAGG + Intergenic
1023175893 7:37435000-37435022 AGGCCTATTTTTCTCTTGGAAGG + Intronic
1027468796 7:78548087-78548109 AAGGCTCTTTCTAACTCTGAAGG - Intronic
1031339785 7:120585045-120585067 AGGGCTTTTTCTAACTCTGAAGG + Intronic
1032525081 7:132573904-132573926 TGAGGTCTTTCTCACTGGGAAGG - Intronic
1033961857 7:146923582-146923604 AGATCTCTTTCTCCCTTGAAGGG - Intronic
1036053376 8:5225118-5225140 AAGGCTCTTACTCCCTTGGCTGG + Intergenic
1039463539 8:37765504-37765526 ATGGCTCTTTCCCTCTTGGCAGG + Exonic
1042581475 8:70284025-70284047 GGGGCTGTTTCTAACATGGAGGG - Intronic
1044858306 8:96497324-96497346 AGGGCTCTTTCTCTCTTAGTTGG + Intronic
1048509130 8:135046575-135046597 AGGGCTTTTATTAACTTGGATGG + Intergenic
1052103934 9:24488068-24488090 AGTGCAATTTCTCACTAGGAAGG - Intergenic
1053167391 9:35854159-35854181 AGGGCTTTGTCTCCCTGGGAAGG - Exonic
1056965789 9:91161946-91161968 AGAGCCCTTCCTCACTCGGAAGG + Intergenic
1057062724 9:92019964-92019986 AGGACTCTTTGTCACCTGGAAGG + Intergenic
1061542779 9:131287283-131287305 AGGGCTCTTTCTGTCTGTGATGG - Intergenic
1061853085 9:133427521-133427543 AGGGCTCCTTCTCCCTCAGAGGG + Intronic
1061887957 9:133602247-133602269 CTGGCTCTTTCCCACTTGCAGGG - Intergenic
1186615756 X:11186430-11186452 ACGGCTCTGTGTCACTTGCAGGG - Exonic
1187223378 X:17352563-17352585 GGGGCTTTTTCTGATTTGGAAGG - Intergenic
1190302677 X:49065621-49065643 GGGGCTCATTCTCACCTGGTGGG - Exonic
1192698813 X:73446820-73446842 AGGTCTCTATCTGACTTTGAGGG + Intergenic
1192972283 X:76245548-76245570 ATGGCTCTTTCCCAATTGAAGGG + Intergenic
1197377025 X:125693067-125693089 ATGGCTCTATCTCACATGGTTGG - Intergenic
1198891218 X:141398997-141399019 TGGGCTTTTTTTCACTTGGTAGG + Intergenic
1199666897 X:150103566-150103588 AAGGCTCTTTCTGGCCTGGAGGG - Intergenic
1201142951 Y:11043562-11043584 AGGGCCCTCTCTCACTTGCATGG + Intergenic
1201607155 Y:15799662-15799684 GGTGCTCTCTCTCACTTTGATGG + Intergenic