ID: 1094545638

View in Genome Browser
Species Human (GRCh38)
Location 12:31402124-31402146
Sequence TGCCAAAGGATGACCAGGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 128}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094545633_1094545638 10 Left 1094545633 12:31402091-31402113 CCATAAGCATGAATATCAGCTCT 0: 1
1: 0
2: 0
3: 7
4: 133
Right 1094545638 12:31402124-31402146 TGCCAAAGGATGACCAGGTTTGG 0: 1
1: 0
2: 0
3: 15
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094545638 Original CRISPR TGCCAAAGGATGACCAGGTT TGG Intronic
906285029 1:44581593-44581615 TGCCAAAGGATGATCGTCTTAGG - Intronic
910367700 1:86484383-86484405 TGCCAAAGGCTGGCAAGTTTGGG + Intronic
916168066 1:161980948-161980970 TGCCAAAGGCGGAGCTGGTTTGG + Intergenic
920562256 1:206947191-206947213 TGCCAAAACATGACCTGGTTGGG + Intergenic
920764260 1:208816799-208816821 TGCCTAAGGTTGTGCAGGTTGGG + Intergenic
920780391 1:208985465-208985487 TGCCAAAGGGTCAGCAGGTAAGG - Intergenic
923617946 1:235553206-235553228 GGCCAGAGGAAGAGCAGGTTGGG + Intronic
1066067859 10:31775195-31775217 TGCCACAAGGTGACCAGGTCAGG + Intergenic
1067705086 10:48600775-48600797 TGGCAGAGGATGTCCAGGCTTGG + Intronic
1068128246 10:52867322-52867344 AGCCAAAGAATGACAAGGATAGG - Intergenic
1071038884 10:81282540-81282562 TGCCAAAGGTTGCCCCGCTTAGG + Intergenic
1073250257 10:102116986-102117008 TGAGACAGGATGACCAGGGTGGG + Intronic
1073559782 10:104486951-104486973 GGCCAAAGGGTTTCCAGGTTGGG + Intergenic
1075743834 10:124712705-124712727 TGCCAAAGGAGGGCTAGGTGAGG + Intronic
1077176987 11:1195507-1195529 TGCCAAGGGGTCACCAGGGTTGG + Intronic
1078267321 11:9765122-9765144 CACCAAAGGATGACCAGGGTTGG - Intergenic
1078267641 11:9766789-9766811 AGAGAAAGGATGACCAGGTGGGG - Intergenic
1078450749 11:11438859-11438881 TGTCACAGGAAGACCATGTTGGG - Intronic
1079729045 11:23917523-23917545 TGCCCCTGAATGACCAGGTTTGG - Intergenic
1083141153 11:60722891-60722913 TCCCAAGAAATGACCAGGTTGGG + Intergenic
1085638045 11:78173255-78173277 TGCCCAGGGGTGACCATGTTTGG - Exonic
1085961875 11:81470605-81470627 GGCCAAAGGGTGAACAGGTTTGG - Intergenic
1086259754 11:84924720-84924742 TGCCCAAGGATCTCCAGCTTAGG - Intronic
1087826685 11:102772546-102772568 TGCCATAGGAAGCCCAGGTGTGG - Intronic
1093221084 12:16421294-16421316 TGCCAAGAGATGACCAGGGAAGG - Intronic
1094545638 12:31402124-31402146 TGCCAAAGGATGACCAGGTTTGG + Intronic
1096996945 12:55844164-55844186 TGTCAAAGAATGACCAGGGTGGG + Intergenic
1097338363 12:58409792-58409814 TGCCAAAGCAAGAACAGGTCAGG + Intergenic
1100377364 12:94029830-94029852 TGTCAAAGGATGAGCAGGCAGGG - Intergenic
1102673190 12:114637446-114637468 TGACAAAGGGAGACCAGGTGCGG + Intergenic
1105844795 13:24284970-24284992 GGCCAAAGGAACACCAGATTTGG - Intronic
1105932044 13:25061763-25061785 TGTGTTAGGATGACCAGGTTTGG - Intergenic
1108470844 13:50765520-50765542 TGCCAGAAGAGGACCAAGTTGGG - Intronic
1110901007 13:80824462-80824484 TGCCTTAGGAAGTCCAGGTTGGG + Intergenic
1112372627 13:98807645-98807667 TGGCAAGGTATGACCATGTTTGG - Exonic
1114809622 14:25882281-25882303 TGCCCAAGTTTGACCAGGTCAGG - Intergenic
1115835736 14:37399871-37399893 TGGCAATAGGTGACCAGGTTTGG - Intronic
1120293665 14:82610613-82610635 AACCAAAGGATGAGCAGGGTTGG + Intergenic
1120906433 14:89625121-89625143 TGCCAAAGCAAGCCCGGGTTTGG - Intergenic
1124168376 15:27350014-27350036 AGCCAAAAGATTACCAGGTTAGG + Intronic
1126840779 15:52715492-52715514 TGCCAGAGGATGGCCAGGACAGG + Intergenic
1130879870 15:88045737-88045759 TGCCAAGGAATGACAAGGATTGG - Intronic
1133566890 16:7004411-7004433 AGCCAAATGCTGACCAGCTTGGG - Intronic
1134791124 16:16990242-16990264 CCCAGAAGGATGACCAGGTTTGG + Intergenic
1135829411 16:25760326-25760348 GACCAATGGATGACCAGGTGAGG - Intronic
1139896327 16:70290306-70290328 GGCCAACGGATGACGAGGTCAGG + Intronic
1140151942 16:72376316-72376338 TGCTAAGGGATAACCAGGTTTGG + Intergenic
1140737486 16:77911358-77911380 TGCCACAGGATGAGAAGGTCTGG - Intronic
1141003644 16:80331716-80331738 TTCCAAAAGAGGACTAGGTTTGG + Intergenic
1141046628 16:80721410-80721432 TTCCAAGGCATGAGCAGGTTTGG + Intronic
1144845765 17:18218041-18218063 TGCCAAAGGAGGCCCCGGTCTGG - Intergenic
1150283939 17:63945135-63945157 TGGCAGGGGAGGACCAGGTTGGG - Intronic
1153550307 18:6255921-6255943 AGCCAAATGATGACCATGTCTGG - Intronic
1153810920 18:8750860-8750882 TGCCAAAGGGGGACCAGCTTGGG - Intronic
1154412701 18:14149945-14149967 AGCAAAAGGATGACCGGGTGGGG + Intergenic
1155979801 18:32168189-32168211 TGTCAAGGCATGACCTGGTTTGG + Intronic
1156762677 18:40612485-40612507 TCCCAAACAATGAACAGGTTTGG + Intergenic
1159431238 18:68356356-68356378 GGCCAAGGGAGGTCCAGGTTAGG + Intergenic
1164624271 19:29715766-29715788 TGCAAAAGGAGAAGCAGGTTGGG + Intronic
1165645128 19:37429531-37429553 TGCCAAAGGATGGCCAGATCTGG - Intronic
1166567097 19:43771943-43771965 GGCCAGAGGATGACCAGTTTGGG + Intronic
1167880578 19:52454034-52454056 AGCCCAAGGAGGACAAGGTTGGG - Intronic
926767248 2:16332846-16332868 TGCCTGAGCATGATCAGGTTTGG + Intergenic
927572723 2:24174615-24174637 TGCCACAGGTGGACCTGGTTTGG - Exonic
928452465 2:31388746-31388768 TGCCAAAGGATGTCCAAGACGGG + Intronic
929822200 2:45282661-45282683 TGCCAAAGGCTGACCTGGCAGGG - Intergenic
930258762 2:49121045-49121067 TTTCAAAGGATGACCATGTTAGG - Intronic
930526534 2:52537250-52537272 TGCAAAAGGTTGGCCAGGGTTGG + Intergenic
932090332 2:68800285-68800307 TGACAAAGGAGGACCAAGGTAGG + Intronic
932131314 2:69189815-69189837 TGCAAAAGGAGGAGCAGGTTTGG + Intronic
934682762 2:96297026-96297048 TGCCAAAGTATGCCCAGGCTGGG - Exonic
934699430 2:96427924-96427946 GGCCAAAGGGTGAACAGGGTTGG + Intergenic
936032679 2:109084976-109084998 TGCCCAAGGTTCACCAGGTCAGG - Intergenic
936033021 2:109087211-109087233 TTCAACAGGATGACCAGGCTGGG + Intergenic
936492499 2:112984428-112984450 TGACAAAGGACAGCCAGGTTAGG - Intronic
940246334 2:151621089-151621111 TGCCAAAGGAAGACCACTTTTGG + Intronic
940772029 2:157849613-157849635 TGCCAAAAGATAATGAGGTTTGG - Intronic
941395437 2:164968039-164968061 TGCCAAACCACAACCAGGTTGGG + Intergenic
943009788 2:182433288-182433310 TCCCAGAGGAGGAGCAGGTTTGG - Intronic
944235373 2:197437264-197437286 TTCCAAAGGCTGAGCAGCTTGGG - Intergenic
946493261 2:220170730-220170752 AGCCAAAGAATGGCCAGGGTTGG + Intergenic
1176860305 21:14008310-14008332 AGCAAAAGGATGACCGGGTGGGG - Intergenic
1183164158 22:36134828-36134850 TGAAAAATGATGACCAGGTGAGG - Intergenic
1184609110 22:45591100-45591122 TGCCAAAGGAAGACAAGGTCTGG - Intronic
1185365567 22:50435089-50435111 AGCAGAAGGATGACCGGGTTGGG - Intronic
950051271 3:9991673-9991695 TGCAAAAGGATAATCAGGCTGGG - Intronic
950300081 3:11869251-11869273 TGCAAAAGGATAATCAGGCTGGG - Intergenic
951865835 3:27306263-27306285 TGACAAAGGATTACAAGGATGGG - Intronic
952977185 3:38706541-38706563 TGGGAATGGATGAACAGGTTTGG - Intronic
955446436 3:59015940-59015962 TACCAATGGATGCCCAGGCTGGG + Intronic
956170584 3:66430701-66430723 TGGCAAAGCAGTACCAGGTTGGG + Intronic
961399165 3:126622922-126622944 GACCAAAGGATGACCATGTGAGG + Intronic
962592458 3:136905319-136905341 TCACAAAGGAAAACCAGGTTGGG - Intronic
965773788 3:172208409-172208431 TCCCAGAGGTTGAGCAGGTTAGG + Intronic
966297612 3:178442283-178442305 TCTCAAAGGATGAGCAGGTGTGG + Intronic
967492789 3:190112820-190112842 TGGCAAATGATGACAAGGTCTGG + Intronic
968315413 3:197720178-197720200 TGCCAGAGGATGAGGAGGGTAGG - Intronic
972865899 4:43232173-43232195 AGCAAAAGGATGACTAGGTGGGG + Intergenic
975169871 4:71221415-71221437 TGGCAAAGGATGACAAGCTCAGG + Intronic
978810544 4:112844654-112844676 AGGCAAAGGAAGACAAGGTTTGG + Intronic
981638937 4:146912981-146913003 CACGAAAGGATGAACAGGTTTGG + Intronic
982491262 4:156032291-156032313 GGCCAAAGGATTAACAGGTGGGG - Intergenic
984258339 4:177413690-177413712 TGCCAAAAGAAAAGCAGGTTTGG + Intergenic
984277435 4:177627298-177627320 GGCCAGGGGATGAACAGGTTTGG - Intergenic
984485024 4:180357256-180357278 TATCAAAGAATGAACAGGTTTGG + Intergenic
985788432 5:1912000-1912022 TGCCAAGGGATGTCCACGTGTGG + Intergenic
988459255 5:31417888-31417910 TGACATAGGAAGACCAGGGTAGG + Intronic
989565803 5:42899536-42899558 TCCCAAAGCTTGACCAGGTCCGG + Intergenic
990417137 5:55597350-55597372 TGCCAAAGGATGACAAAGCCAGG + Intergenic
992850015 5:80797607-80797629 TGCCAGAGGTTGCTCAGGTTGGG + Intronic
993949884 5:94161408-94161430 TGAAGAAGGATGAGCAGGTTTGG - Intronic
994040931 5:95259265-95259287 GGTCAAAGGAAGTCCAGGTTGGG - Intronic
996572753 5:124949968-124949990 TGACAAAGGTTGACCACTTTGGG - Intergenic
1000202870 5:159028862-159028884 TCCCAAGGGATGAACAGGTTTGG + Intronic
1003775658 6:9359967-9359989 TACCAAAGGCTGACAAGGATAGG + Intergenic
1003939855 6:11013829-11013851 GGCCAAAGGATGACCAGAAGGGG - Intronic
1007174688 6:39887796-39887818 TGCCAGACGCTGACCAGGCTGGG - Intronic
1007598463 6:43066569-43066591 AGCCAAAGGAGGACCAAGGTGGG - Intronic
1015526342 6:134177706-134177728 TGCCCAAGGATATGCAGGTTGGG + Intronic
1019894782 7:3975356-3975378 TGTCAAACGATGACCAGGGACGG - Intronic
1024131724 7:46360325-46360347 TGCCAAAGGCTGATCACCTTAGG - Intergenic
1029358381 7:100070014-100070036 TGCTACAGGATGAGCAGGGTTGG + Exonic
1029414248 7:100433098-100433120 TGCCATACGACGACCAGGGTTGG - Exonic
1030771650 7:113483170-113483192 TTCCAAAGGATGAACAGAATGGG - Intergenic
1037496811 8:19448321-19448343 TTACAAAGGATGACCATGTATGG + Intronic
1037779232 8:21856297-21856319 TGCCCAAGGATGACCTGGGATGG + Intergenic
1038433166 8:27515926-27515948 CTCCAAAGTGTGACCAGGTTGGG + Intronic
1041978875 8:63832098-63832120 TGCCAAGGGAGGGCCAGGTGGGG + Intergenic
1044429005 8:92086850-92086872 TGCAGAAGGATGACCAGCGTTGG - Intronic
1044898776 8:96922191-96922213 TTCCAAAGTATGACCAGCATTGG + Intronic
1058091060 9:100805857-100805879 TGGGAAAGGATGGCCAGGTGGGG + Intergenic
1060586180 9:124787464-124787486 TGCCAATGGATGAATTGGTTTGG - Intronic
1062532407 9:137007712-137007734 TGCCAAAGGCTGACCCGGCCCGG - Exonic
1185661791 X:1734253-1734275 TGCAAAAAGCTGGCCAGGTTTGG - Intergenic
1185823494 X:3227111-3227133 AAGCAAAGGTTGACCAGGTTTGG + Intergenic
1189531089 X:41883930-41883952 TGCCAAAGGAAGGGCAGGTATGG - Intronic
1189640436 X:43064090-43064112 TCCCAATGGATGATCAAGTTAGG + Intergenic
1191026411 X:55918936-55918958 GGCCAAAGGAAGACCATTTTGGG - Intergenic
1192167221 X:68833575-68833597 TGCCATGGGAACACCAGGTTTGG + Intronic
1192590372 X:72354820-72354842 TGACAAATGCTGACCTGGTTGGG + Intronic
1193261675 X:79414356-79414378 TGCCAAAGGCTTCCTAGGTTAGG + Intergenic
1194369831 X:93058978-93059000 TGCCAAAGTCAGAGCAGGTTTGG - Intergenic
1197789827 X:130242971-130242993 TGAAAAAGTATGATCAGGTTGGG - Intronic
1201991051 Y:20026657-20026679 AGGCAGAGGAGGACCAGGTTTGG + Intergenic