ID: 1094551062

View in Genome Browser
Species Human (GRCh38)
Location 12:31451973-31451995
Sequence CAGCCAGGATTCCATGTCCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 214}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094551062 Original CRISPR CAGCCAGGATTCCATGTCCT GGG Exonic
901381946 1:8879985-8880007 CAGACAGGTTTCCATGGCGTTGG + Intergenic
901550461 1:9992496-9992518 CAGCAAGAGTTCCATGTCCCAGG + Intergenic
902040214 1:13486968-13486990 CACCCAAGATTCAGTGTCCTGGG - Intronic
902521327 1:17018662-17018684 GTGCCAGGAGTCCTTGTCCTTGG - Intergenic
904760022 1:32796444-32796466 CAGCCAGGATCACACCTCCTGGG + Intronic
905741073 1:40372350-40372372 CAGGCTGGATTCCAACTCCTGGG + Intronic
905929450 1:41777010-41777032 GAACCAGGAGTCCAAGTCCTGGG - Intronic
907612764 1:55889130-55889152 TGGCCAGGATTCCATTTCCAGGG + Intergenic
910164715 1:84314246-84314268 CAGTCAGGTCTCCATCTCCTTGG + Intronic
910482952 1:87678336-87678358 CACCCAGGATTTCCTCTCCTTGG - Intergenic
912613212 1:111069892-111069914 CAGCCAGAAATCTATTTCCTAGG + Intergenic
914708005 1:150187265-150187287 CAGACAGGTCTCCATCTCCTGGG + Intergenic
915279495 1:154812983-154813005 TAGCCAGAATTCCATGTCTGAGG - Intronic
916691116 1:167190778-167190800 GAGCCAGGATCCCATTTACTGGG - Intergenic
917878329 1:179307518-179307540 CAGGCTGGATTCCAACTCCTAGG - Intronic
920873821 1:209816213-209816235 CAGCCTGGATTCCACTGCCTAGG + Intergenic
1063376464 10:5557442-5557464 CACCCAGGCTTCTATGTCCTCGG + Intergenic
1063467479 10:6256527-6256549 CAGCCAGGCTGCCATGTGCATGG + Intergenic
1067372587 10:45699261-45699283 CAGCCCGGTGTCCATGTCCTTGG - Intergenic
1067387190 10:45826863-45826885 CAGCCCGGTGTCCATGTCCTTGG + Exonic
1067418938 10:46130388-46130410 CAGCCCGGTGTCCATGTCCTTGG - Intergenic
1067433667 10:46263023-46263045 GAGCCAGGATTCCAGGGCCCAGG + Intergenic
1067440014 10:46303285-46303307 GAGCCAGGATTCCAAGGCCCAGG - Intronic
1067447086 10:46357744-46357766 CAGCCCGGTGTCCATGTCCTTGG - Intergenic
1067504290 10:46836977-46836999 CAGCCCGATGTCCATGTCCTTGG - Intergenic
1067590297 10:47503016-47503038 CAGCCCGGTGTCCATGTCCTTGG + Exonic
1067637417 10:48011118-48011140 CAGCCCGGTGTCCATGTCCTTGG + Intergenic
1067876072 10:50009216-50009238 CAGCCCGGTGTCCATGTCCTTGG - Exonic
1070134014 10:73675547-73675569 CAGCCCGGTGTCCATGTCCTTGG + Exonic
1072579621 10:96729385-96729407 CAGGCCCCATTCCATGTCCTGGG - Intergenic
1073029232 10:100511557-100511579 CAGGCTGGCTTCCATCTCCTGGG - Intronic
1073296936 10:102446155-102446177 CAGTCAGAATTCCAGGTACTGGG - Intergenic
1073417606 10:103397042-103397064 CATCCCTGATTCCATATCCTTGG + Intronic
1073648302 10:105330405-105330427 CCGGCAGAATTCCTTGTCCTTGG + Intergenic
1074433581 10:113414788-113414810 AGGCCTGGATTCCCTGTCCTTGG - Intergenic
1075723726 10:124601341-124601363 AAGCCAGGTTTCCAGCTCCTAGG + Intronic
1077047866 11:554288-554310 CTGCCAGGCTTCCCTGTGCTGGG + Exonic
1079504632 11:21139706-21139728 CAGCAAATATTCAATGTCCTGGG + Intronic
1079563018 11:21846425-21846447 CTCCCAGAATTCCATGTTCTGGG - Intergenic
1080063816 11:27986042-27986064 CAGCCAAAATTCCAGGTCCCAGG + Intergenic
1081540868 11:44033675-44033697 CAAGCAGGATACCAAGTCCTGGG + Intergenic
1083892202 11:65601172-65601194 CAGCCAGGTTGCCTTTTCCTTGG + Intronic
1084000222 11:66292001-66292023 CAGCCAGGACACCATGCCCGAGG + Exonic
1084665648 11:70574801-70574823 CAGAGGGGCTTCCATGTCCTGGG - Intronic
1086251099 11:84815328-84815350 AAACCAGGATTCCATGTCCTGGG - Intronic
1091312000 11:134581238-134581260 CAGCAGGGAGTCCATGTCCATGG + Intergenic
1092006821 12:5077049-5077071 CAGCCAGCACTCCATGTCCAGGG + Intergenic
1094366993 12:29694568-29694590 CAGCCAGCCTTCCATATCCGTGG - Intronic
1094551062 12:31451973-31451995 CAGCCAGGATTCCATGTCCTGGG + Exonic
1102036286 12:109772188-109772210 CACCCAGGTCCCCATGTCCTTGG + Intergenic
1103849286 12:123921250-123921272 CAGCCAGGATTACATACTCTAGG - Intronic
1103933022 12:124460552-124460574 CAGAGAGGACTCCGTGTCCTTGG - Intronic
1104054792 12:125221234-125221256 CAGGCAGCATTCTAGGTCCTGGG - Intronic
1104450377 12:128864089-128864111 CAGCCAGCATTCCACGTGCAGGG - Intronic
1108463593 13:50692534-50692556 CAGACAGTATTCCAGGTGCTTGG - Intronic
1112198445 13:97250004-97250026 CAACCAGACTTCCGTGTCCTGGG - Intronic
1112536156 13:100257945-100257967 CAGTCAGGATTCTATTTTCTGGG + Intronic
1113767597 13:112890781-112890803 CAGTGAGGATTCCAGGTGCTGGG + Intergenic
1114559520 14:23580057-23580079 CTGCCAGGATTCCATGAACTTGG + Intergenic
1114687507 14:24548082-24548104 GAGACAGGATCCCATGGCCTTGG + Intergenic
1116597860 14:46875264-46875286 CAACCAGGACTCCATTTCCAAGG - Intronic
1116631904 14:47346746-47346768 CTGCCAGCATTCCAAGTACTGGG + Intronic
1116963950 14:50995060-50995082 CAGGCAGGATTCAAACTCCTGGG + Intronic
1118304503 14:64644494-64644516 CAGCCAGCATTCATTCTCCTAGG + Intergenic
1121913443 14:97813994-97814016 CAGCCAGGTTTCAAACTCCTGGG + Intergenic
1122055593 14:99096153-99096175 CGTCCAGGTTTCCATCTCCTGGG + Intergenic
1124070743 15:26390960-26390982 CAGCCAGCAGTCCAGGGCCTGGG + Intergenic
1125836858 15:42759455-42759477 CAGCCATGAGCCCATGTCCCTGG + Intronic
1129461219 15:75700937-75700959 CAGACAGAAGTCCATGTCCAGGG + Intronic
1130043786 15:80428614-80428636 AAGCCAGTCTTCCAAGTCCTTGG + Intronic
1130916144 15:88306253-88306275 CACCCAGGACTCCCTGTTCTGGG + Intergenic
1131334978 15:91540073-91540095 CATCCAGCACTGCATGTCCTTGG - Intergenic
1131441666 15:92464286-92464308 CAGCCCGCATACCATGCCCTTGG + Exonic
1131498317 15:92934845-92934867 AAGCCAGGCTTACACGTCCTGGG - Intronic
1132092841 15:98959600-98959622 CGGCCAGGAATCCAGGTCCTTGG + Exonic
1134561527 16:15214316-15214338 CAGGCAGGATTCAAACTCCTGGG - Intergenic
1134922064 16:18125942-18125964 CAGGCAGGATTCAAACTCCTGGG - Intergenic
1136449225 16:30343253-30343275 CAGGCAGGATGCCACGTCATAGG - Intergenic
1137839739 16:51629337-51629359 CTACCAGGGTGCCATGTCCTTGG + Intergenic
1138846444 16:60573031-60573053 AAGCCAAGGTTCCAAGTCCTGGG - Intergenic
1139867925 16:70078538-70078560 CACCCATGATTCCAGCTCCTTGG + Intergenic
1139971105 16:70775722-70775744 CAGCCAGGACTCCATGCCCCTGG + Intronic
1140364964 16:74374203-74374225 CACCCATGATTCCAGCTCCTTGG - Intergenic
1140387409 16:74553320-74553342 CACCCATGATTCCAGCTCCTTGG - Intronic
1140897508 16:79337851-79337873 AAGCCACGATTCCATTTACTTGG - Intergenic
1142145869 16:88492746-88492768 CAGCCAGGCTGCCCTGTCCCTGG + Intronic
1142553898 17:759010-759032 CAGCTTGAATTCCATATCCTAGG - Intronic
1142815288 17:2420290-2420312 GAGCCAGGAGTCCCTGTCCCAGG - Exonic
1143472699 17:7185795-7185817 CAGCCAGGATTCTCTGACCCAGG + Intergenic
1146088380 17:29851646-29851668 CAGGCAGGTTTCCAACTCCTGGG - Intronic
1146748472 17:35353605-35353627 CAGCAGGGCTTCCATGTGCTGGG + Exonic
1146757010 17:35441832-35441854 CAGCAGGGCTTCCATGTGCTGGG + Exonic
1147244094 17:39109208-39109230 CAGCCATGCTTCCCTGTGCTGGG - Intronic
1147900144 17:43778598-43778620 CAGGCAGGGTTCCAGTTCCTTGG + Intronic
1152132154 17:78484223-78484245 CAGCCAGAATCCCAGGGCCTCGG - Intronic
1152253522 17:79224221-79224243 CTGCCTGGATTCCCTGTCCTTGG - Intronic
1152274093 17:79344157-79344179 CAGCTAGGGTTCTATGTCCCGGG + Intronic
1153585292 18:6614641-6614663 CAGCAAGAATACCATGACCTGGG + Intergenic
1153917734 18:9760660-9760682 CAGCCAGGATCCTTAGTCCTGGG - Intronic
1155983937 18:32209837-32209859 CAGCCAGGAAACCAGGGCCTTGG - Intronic
1157223490 18:45843057-45843079 GAGCCTGGTTTCCATTTCCTAGG - Intronic
1157774108 18:50377674-50377696 CAGACAGAATTCCATGTGCTGGG + Intronic
1160424108 18:78768473-78768495 CAGCCATGAAGCCATGTCCTTGG - Intergenic
1162290802 19:9778852-9778874 CAGGCTGGATTCCAACTCCTGGG + Intronic
1163353021 19:16791377-16791399 GAGCCGGTATTCCATATCCTGGG + Exonic
1163780068 19:19241624-19241646 CAGGCTGGATTCCAATTCCTAGG - Intronic
1165793336 19:38505216-38505238 CCCCCAGGATTCTCTGTCCTCGG + Intronic
1166320422 19:42014842-42014864 CAGGCAGGTTTCCAACTCCTGGG - Intronic
1166938743 19:46350445-46350467 GAGCCTGGATCCCAGGTCCTGGG - Intronic
1167581182 19:50343905-50343927 CAGGCTGGTCTCCATGTCCTGGG - Intronic
1167735932 19:51294601-51294623 GGGCCAGGTTTCCACGTCCTGGG - Intergenic
1168594488 19:57664415-57664437 CACCAAGGATTCCCTGACCTGGG - Intergenic
925087240 2:1117710-1117732 CAGTGAGGACTCCATGCCCTGGG - Intronic
925412915 2:3650335-3650357 CAGCCAGGATTCCCTGTCTGTGG + Intergenic
925734664 2:6951714-6951736 CAGCAAAGATTCCATTTCCAAGG - Intronic
926182729 2:10660109-10660131 CAGCCAGGACTCTAGGTCCTGGG - Intronic
927157445 2:20229247-20229269 CAGCCAGGATACCATTTTCATGG - Intergenic
927611607 2:24547007-24547029 CAGCCAGGATTCAAGGGACTGGG + Intronic
928518051 2:32062635-32062657 CAGCCAAGATTCCAGGTCCCAGG + Intergenic
930713439 2:54571079-54571101 CAGCCAGGATTTCATCTGCTTGG - Intronic
930824825 2:55686030-55686052 CAGTCAGCCCTCCATGTCCTTGG - Intronic
933228651 2:79780134-79780156 AAGCCAGGCTTCCAAGTTCTAGG - Intronic
934762136 2:96862324-96862346 CTGCCATTATTCCATGTTCTAGG + Intronic
937123685 2:119459062-119459084 CACTCAGGAATCCATATCCTGGG + Intronic
938970284 2:136425193-136425215 TAGTCAGGATTCCATTTACTGGG + Intergenic
943223916 2:185144651-185144673 CAGCCAGGTGTGCATGTACTCGG + Intergenic
944406872 2:199394580-199394602 CAGCCTGGTTTCCAACTCCTGGG - Intronic
944850803 2:203717055-203717077 CAGGCTGGTTTCCATCTCCTGGG + Intronic
946329222 2:219000407-219000429 GGGCCAGGATTCCACATCCTGGG - Intergenic
948459259 2:238121208-238121230 CAGCCAGGATCCCAGCTCCTTGG - Intronic
948657511 2:239485824-239485846 CTGCCAGGATCCCATGTCCCTGG - Intergenic
1169455928 20:5752491-5752513 CAGCCAGGATTTCCTTTTCTAGG - Intronic
1170915209 20:20616644-20616666 CAGCAAGGAGTTCATGTGCTGGG - Intronic
1171258444 20:23710047-23710069 CACCCAGGAGGCCATGACCTGGG - Intergenic
1171275673 20:23855077-23855099 CACCCAGGAGGCCATGACCTGGG - Intergenic
1172386733 20:34539292-34539314 CAGCCTGGATTCCAGCTCCAGGG - Intronic
1172875362 20:38160874-38160896 CAGGCTGGATTCAAAGTCCTAGG + Intronic
1173569601 20:44067799-44067821 CAGCCAGGTTCCCATTCCCTTGG + Intronic
1173650327 20:44659666-44659688 CAGCCAGGTTTCAACTTCCTGGG + Intergenic
1174082474 20:47980343-47980365 AACCCATGATTCCATTTCCTTGG + Intergenic
1174199125 20:48794658-48794680 CAGCCAGGTTGCCATGGCCACGG + Intronic
1174484530 20:50852847-50852869 CACCCACGAGTTCATGTCCTGGG - Intronic
1185198012 22:49484484-49484506 CAGCAGTGATCCCATGTCCTTGG - Intronic
949782263 3:7703055-7703077 CACCCAGGATTCTATGTAATTGG + Intronic
949839459 3:8304336-8304358 AAGCCATTATTCCATGTCATTGG - Intergenic
953136123 3:40183204-40183226 CAGCCAGGATGCCATTTCTCCGG - Intronic
954359794 3:50115190-50115212 CACCCAGGAATCCATTTCTTAGG + Intronic
954431885 3:50475262-50475284 CAGTCAGGAGTCCAGGTCCAGGG - Intronic
955339414 3:58113534-58113556 CAGTAAGGATTCCATCTCCAAGG - Intronic
956785767 3:72641028-72641050 CAGTGAGGATTACATTTCCTGGG - Intergenic
960280151 3:115772235-115772257 CAGCCAGTATTCTAAGTGCTGGG + Intergenic
960442487 3:117706187-117706209 CAGCCAGGAGGACATGCCCTGGG - Intergenic
961861272 3:129918426-129918448 CTGTCAGGTTTCCATGTTCTTGG - Intergenic
962060902 3:131926210-131926232 CTGCCAGCATTCCATCACCTTGG - Intronic
966026498 3:175289748-175289770 CAGGCAGGATTCAAACTCCTGGG - Intronic
968527139 4:1066131-1066153 CAGGCTGGACTCCATCTCCTTGG + Intronic
968897538 4:3413333-3413355 CAGGCAGGATCCGGTGTCCTGGG + Intronic
969269457 4:6089196-6089218 CATCCAGGATCCCAGGTTCTTGG - Intronic
969617223 4:8260965-8260987 CAGCCTTGATTACATTTCCTCGG + Intergenic
970663105 4:18308115-18308137 CAGCCAGCAGAGCATGTCCTGGG + Intergenic
971418640 4:26455912-26455934 TAGGCAGGTTCCCATGTCCTGGG + Intergenic
971735941 4:30452156-30452178 CAGTCAGACTTCCATGTCCATGG - Intergenic
972149596 4:36072560-36072582 CAGCCTGTGTTCCCTGTCCTGGG + Intronic
972383129 4:38537519-38537541 CAGCCAGGCTTTTATGTTCTTGG - Intergenic
972558263 4:40202155-40202177 CAGCCTGGTCTCCATCTCCTGGG + Intronic
973784759 4:54324370-54324392 CCACCAGGATTCCAGGCCCTTGG + Intergenic
974301767 4:60078311-60078333 CATCCAGAATTGCATTTCCTAGG + Intergenic
974647476 4:64714011-64714033 CAGCCAGAATTCCATGTTGTGGG + Intergenic
977290327 4:95159048-95159070 CCATCAGGATTCCCTGTCCTGGG - Intergenic
977290381 4:95159519-95159541 CCATCAGGATTCCCTGTCCTGGG - Intergenic
978889120 4:113801252-113801274 CAGACAGGCTTCCCTGTTCTAGG + Intergenic
981228016 4:142319542-142319564 CAACCAGGATTCCATATCCTAGG + Intronic
982625456 4:157760558-157760580 CAGCCAAGCTCCCATGTCCCAGG + Intergenic
984599225 4:181706935-181706957 CAGCCAGGTTGCCATCTCCCTGG + Intergenic
986050805 5:4088444-4088466 CCACTAGGACTCCATGTCCTAGG + Intergenic
986634978 5:9812202-9812224 CAGACAGTATTCCAGGTACTGGG - Intergenic
988190649 5:27929041-27929063 CTGCTATGCTTCCATGTCCTAGG + Intergenic
989455281 5:41637032-41637054 AAGCCAGGTTCCCATGACCTAGG + Intergenic
992124086 5:73624234-73624256 CAGCTAGCATTGTATGTCCTTGG + Intergenic
994169994 5:96648920-96648942 CAGACAGTATTCCAGGCCCTGGG - Intronic
994263877 5:97691769-97691791 CAGACCGGTTTCAATGTCCTAGG + Intergenic
994821884 5:104662795-104662817 CAGGCTGGATTCCAACTCCTGGG + Intergenic
1000284463 5:159815132-159815154 AAGCCATGCTTCCATGACCTCGG - Intergenic
1001830936 5:174788916-174788938 CAGCCATGATTACAGGTCATGGG - Intergenic
1005407145 6:25501374-25501396 CATCCAGGATTGCATAGCCTAGG - Intronic
1007273396 6:40655716-40655738 CATCCAGGCCTCCCTGTCCTTGG - Intergenic
1007409918 6:41655612-41655634 CAGCCAGCTCTCCATGTGCTGGG - Intergenic
1007711022 6:43824340-43824362 CAGCAAGGAATCCTGGTCCTGGG - Intergenic
1007761621 6:44136598-44136620 CAGCCAGGAGTTCAGGGCCTGGG - Intronic
1008768143 6:54944937-54944959 CAGTCTGGACTCCAAGTCCTGGG + Intergenic
1011887596 6:92116524-92116546 CAGCCAGGAAAACATGACCTTGG + Intergenic
1012171235 6:96018477-96018499 CTGCCAGGATTTAATGTCATTGG + Intronic
1012193278 6:96307641-96307663 TGGTCAGGATTCCTTGTCCTTGG + Intergenic
1012364999 6:98428251-98428273 CAGCCAGGCTCGCATCTCCTTGG + Intergenic
1013353194 6:109324495-109324517 CAGGAACTATTCCATGTCCTAGG + Intergenic
1013450487 6:110275641-110275663 CAGCATGCATTCCCTGTCCTTGG + Intronic
1015365096 6:132388436-132388458 CAGGAATGATTCCATGTGCTTGG - Intronic
1017393891 6:153973643-153973665 GAGCCAGGATTTCATGAACTGGG + Intergenic
1019061748 6:169262417-169262439 CAGCCAGAGGTCCATGCCCTGGG + Intergenic
1019107978 6:169684538-169684560 CAGCCCTGTTCCCATGTCCTGGG + Intronic
1019461446 7:1160865-1160887 CAGGCTGGTCTCCATGTCCTGGG - Intergenic
1019572631 7:1720034-1720056 CACCCGGCATTCCGTGTCCTGGG + Intronic
1020043000 7:5018239-5018261 CCTCCAGGACTCGATGTCCTGGG - Intronic
1023165417 7:37338571-37338593 CATCCAGGTTTAAATGTCCTTGG + Intronic
1026905601 7:74061096-74061118 CAGCCAGGGCTCCAGGTACTGGG - Exonic
1026969224 7:74457842-74457864 CAGCATGGATTCCAAGCCCTGGG - Intronic
1030423469 7:109339738-109339760 CAGATAAGATTCCTTGTCCTAGG - Intergenic
1030572066 7:111239309-111239331 AAGCCAGCATTCCATCTCCTAGG + Intronic
1031988526 7:128179643-128179665 CAGGCAGGATTCAAATTCCTGGG - Intergenic
1031991249 7:128200764-128200786 CAGCCTGGACTCCAACTCCTGGG - Intergenic
1032441974 7:131948842-131948864 CAGGCAGGATTGAGTGTCCTGGG - Intergenic
1032960301 7:137025936-137025958 CAGGCAGGTCTCCATCTCCTGGG - Intergenic
1033767621 7:144511288-144511310 CAGCCACTATTCCCTGTCCTAGG + Intronic
1036479000 8:9121028-9121050 CAGCCAGCATTGTTTGTCCTGGG - Intergenic
1038086563 8:24204149-24204171 CAGCCAGCCTTCCATATCCATGG - Intergenic
1038133529 8:24759860-24759882 CAGCTAAGATTCCCTGTTCTAGG + Intergenic
1039411640 8:37359977-37359999 CAGCCAGGACTGCCTGCCCTAGG + Intergenic
1039503210 8:38032765-38032787 CAGCCAGGTTTCCCTGGCTTAGG - Intronic
1039927643 8:41951656-41951678 CAGCCCTGATTCCATGGGCTGGG - Intronic
1040937562 8:52796962-52796984 CAGCCAGGATTGCTTTTCCCTGG + Intergenic
1041477109 8:58278827-58278849 CAGCCAGAAGTCCTTGCCCTGGG - Intergenic
1049619902 8:143593417-143593439 CAGCCACCAGCCCATGTCCTGGG + Intronic
1050532395 9:6601839-6601861 CAGGCAGGTTTCCAACTCCTGGG + Intronic
1050654466 9:7811274-7811296 CAGCCAGGATACTAAGTCTTTGG + Intronic
1051113884 9:13672620-13672642 CAGACAGTAGTCAATGTCCTGGG - Intergenic
1052506663 9:29363288-29363310 CATCCTGAGTTCCATGTCCTAGG - Intergenic
1052846026 9:33337161-33337183 CAGCCAGCCTTCCATATCCATGG + Intronic
1053339570 9:37312330-37312352 CAGACAGTATTCCAAGTACTAGG + Intronic
1057031934 9:91782734-91782756 CAACCAGGAATCCAGGTCCCAGG + Intronic
1058939696 9:109801616-109801638 AAGCCAGGACTCCAGGACCTGGG + Intronic
1059080556 9:111244502-111244524 CAGCCAGCCTTCCATATCCGTGG + Intergenic
1186735350 X:12457604-12457626 GAGCCAGGATTCAACTTCCTGGG + Intronic
1187328311 X:18312591-18312613 CAGTCAGCTTTCCATATCCTCGG - Intronic
1189135643 X:38546759-38546781 CTGCCAGCATACCTTGTCCTAGG + Intronic
1189734384 X:44054721-44054743 CTCCCAGCATTCCATGTACTAGG + Intergenic
1190797674 X:53759821-53759843 CAGGCAGGTTGCCATGCCCTGGG + Intergenic
1190931283 X:54951299-54951321 CAGGCAGGTTGCCATGCCCTGGG - Intronic
1191246088 X:58229430-58229452 CAGCCAGGATTCTGTCTCATTGG - Intergenic
1193376217 X:80764999-80765021 CAGCCAGGATTCAAGGGTCTAGG + Intronic
1195126446 X:101813607-101813629 CAGCCAGGCGTGCATGTGCTTGG + Intergenic
1198430828 X:136564866-136564888 CAGGTAGGATGCCATGGCCTTGG - Intergenic
1199886259 X:152024690-152024712 CAGTCAGGCTTCCATGTCTCAGG - Intergenic