ID: 1094553911

View in Genome Browser
Species Human (GRCh38)
Location 12:31479113-31479135
Sequence GATCCAAAGTTGATTGCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 68}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094553906_1094553911 24 Left 1094553906 12:31479066-31479088 CCTGCTCACCTTTTCTCTCACTC 0: 1
1: 0
2: 5
3: 101
4: 775
Right 1094553911 12:31479113-31479135 GATCCAAAGTTGATTGCCTCAGG 0: 1
1: 0
2: 2
3: 5
4: 68
1094553907_1094553911 16 Left 1094553907 12:31479074-31479096 CCTTTTCTCTCACTCAGATGAAA 0: 1
1: 0
2: 3
3: 34
4: 381
Right 1094553911 12:31479113-31479135 GATCCAAAGTTGATTGCCTCAGG 0: 1
1: 0
2: 2
3: 5
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094553911 Original CRISPR GATCCAAAGTTGATTGCCTC AGG Intronic
906913358 1:49981073-49981095 GAAACAAAGTTGAATGCTTCTGG + Intronic
912310065 1:108611190-108611212 GATTCTAAGTTGTTTGCCTTAGG - Intronic
915059298 1:153167034-153167056 GAATCAAAGTAGATTGCATCAGG - Intergenic
915848896 1:159299794-159299816 GATACACAGTTGAATGCCACAGG - Intronic
916337727 1:163692371-163692393 GTTCCAATGTTCGTTGCCTCCGG - Intergenic
918748412 1:188238067-188238089 GAAACAAAGTTGATTGGTTCTGG + Intergenic
922335279 1:224614275-224614297 GATCTACATTTTATTGCCTCTGG - Intronic
1074123224 10:110508623-110508645 GGTCCAGAGTGTATTGCCTCTGG - Intronic
1074836324 10:117299272-117299294 AATCCACAGTTGATTGAATCTGG + Intronic
1075282698 10:121154113-121154135 AATCCAAAGTTGTTAGCATCAGG + Intergenic
1075614163 10:123879245-123879267 GTTCCAGAGTTGATTGTCACAGG - Intronic
1075903058 10:126058333-126058355 GAACCACAGTTGACTTCCTCCGG - Intronic
1085070496 11:73539885-73539907 GATCCAAACCTGCTTGCCTTGGG - Intronic
1090550588 11:127815538-127815560 GAGCAGAAGTTAATTGCCTCAGG + Intergenic
1093308536 12:17548482-17548504 GATCCTAAGTTTATTCCCTTTGG + Intergenic
1094553911 12:31479113-31479135 GATCCAAAGTTGATTGCCTCAGG + Intronic
1107332803 13:39319782-39319804 GTTCCAAAGTTGTTTGCCTCAGG - Intergenic
1116335266 14:43649126-43649148 GATCCTAAGTAGATTTCCTTAGG - Intergenic
1117067712 14:52027016-52027038 GAGCCAAGGGTGATTTCCTCTGG - Intronic
1120694670 14:87631435-87631457 CATTCAAAGTTGAATGCCACTGG - Intergenic
1121629782 14:95413682-95413704 GGTCCAAAGATGCTTGTCTCCGG - Intronic
1128410906 15:67395968-67395990 GTTCTAAAGTAGATTCCCTCAGG - Intronic
1130698978 15:86160068-86160090 GATCCAAAATTGATTTAGTCAGG + Intronic
1131777229 15:95815738-95815760 GATCCAAAGTTCAATGGCTATGG - Intergenic
1132358663 15:101193389-101193411 GCTCCAAGGTTGATTCCCTCTGG - Intronic
1135248460 16:20878840-20878862 GAAACAAAGTTCATTGTCTCTGG - Intronic
1139762041 16:69192192-69192214 GCTCCAAAGGTGATCACCTCTGG - Intronic
1143319078 17:6056329-6056351 GAGGCAAAGTTGCTTGCCTAAGG + Intronic
1143875864 17:9990316-9990338 GAGCCAAAGTTCCTTGCCACGGG + Intronic
1144584397 17:16479307-16479329 GTTCCACAGTTCATTGCCTCAGG + Intronic
1145868862 17:28257457-28257479 GATCCAAAGTTCATCGATTCTGG + Intergenic
1153419752 18:4892410-4892432 GATCCAAAGCTGATTTCCCTTGG + Intergenic
1160877053 19:1301371-1301393 AATCCAAAGTTGATTGTGACGGG - Intergenic
931648503 2:64447728-64447750 CATCCAAATTTGATTGCCCAAGG - Intergenic
943041030 2:182805337-182805359 GATCCATTGTTGATTGAATCTGG + Intergenic
944599487 2:201289072-201289094 GATCCAAAGGTGATTTCCATAGG + Intronic
1170392391 20:15889791-15889813 GATGCACAGTTGAGTCCCTCAGG + Intronic
1172048565 20:32099033-32099055 GAGCCAAAGTTGATGGCTTCAGG - Exonic
1173014190 20:39209937-39209959 ACCCCAAAGTTGATTGCCTTTGG - Intergenic
1177055110 21:16292110-16292132 GACCCACAGAAGATTGCCTCAGG + Intergenic
1179637094 21:42720007-42720029 GAGCCAGAGTTGATTTCCTTTGG + Intronic
1179769840 21:43606339-43606361 GATCCAAGGTTGAAAGCATCAGG + Intronic
951363630 3:21753641-21753663 GATACAAAGTTGTTTATCTCTGG + Intronic
953838463 3:46368250-46368272 GATCAAAAGTTCATTTCCTATGG + Intergenic
958504886 3:94962832-94962854 GATCAAAAGTTGTTTGACTTGGG + Intergenic
962921142 3:139951604-139951626 GATCCAAAGGTCATTGTCTCTGG - Intronic
969868456 4:10090594-10090616 AACCCAAACTTGCTTGCCTCAGG + Intronic
970713406 4:18890969-18890991 GATTGAAGGTTGTTTGCCTCAGG + Intergenic
972397211 4:38667685-38667707 GATCCAAAATTGACAGCTTCAGG - Intronic
972780432 4:42282630-42282652 TAACCAAAGCTGATTTCCTCAGG - Intergenic
973330920 4:48909622-48909644 GATCCAAAATTGATTATCACTGG + Intergenic
977376032 4:96205117-96205139 GCTCCAGAGTTGATAGTCTCTGG - Intergenic
984570702 4:181389264-181389286 GATCCATAGTTGATTAACTGTGG - Intergenic
990328353 5:54700101-54700123 GATCCAAGGTTTATGCCCTCAGG - Intergenic
995196953 5:109381219-109381241 GATTCAAAGATGATTTCCTTTGG + Intronic
1003978805 6:11370378-11370400 GATCCAAATTTGCTTTCCTGAGG + Intronic
1006967376 6:38002218-38002240 GATACAAAGATGATACCCTCAGG + Intronic
1012660064 6:101877266-101877288 GATCCCTAGTTGATTGAATCTGG - Intronic
1012957014 6:105581920-105581942 GCTCCAAACTTGATGGGCTCAGG - Intergenic
1016226501 6:141745798-141745820 GATACAAAATTGATTGCTTTTGG - Intergenic
1018647574 6:165962333-165962355 GACCCAAAGGTGAGTGGCTCCGG + Intronic
1020882322 7:13777930-13777952 GATCTAAAGTTGACTCTCTCAGG - Intergenic
1023777309 7:43620140-43620162 GATCCATGGTTGAGTGCTTCTGG + Intronic
1024489621 7:49964906-49964928 GATCCAAAGTTCATGTCCTAAGG - Intronic
1040599195 8:48867989-48868011 AAACCAAAGTTAATTTCCTCAGG + Intergenic
1041258421 8:55999447-55999469 CATCCAAAGTTGATTGCTTCTGG - Exonic
1045818992 8:106312630-106312652 GATCCAAGCTTGAATGACTCAGG + Intronic
1049727245 8:144153694-144153716 GATCCTAATTTCATTTCCTCTGG + Intronic
1050327280 9:4509643-4509665 GATCCAGGGTTCCTTGCCTCTGG - Intronic
1055075449 9:72210374-72210396 TATCCAAATTTTATTGCATCTGG - Intronic
1059853279 9:118367329-118367351 GAGCCAAGGTTAATTGCCTGAGG + Intergenic
1060044595 9:120329611-120329633 GATCCATAGTTGTTTGAATCCGG - Intergenic
1186704188 X:12124761-12124783 GCTCCAAAGTGGAGTGCCTCTGG + Intergenic
1192355881 X:70403173-70403195 GAATGAAAATTGATTGCCTCTGG + Intronic
1196193945 X:112820997-112821019 AGTCCAAAGTGAATTGCCTCTGG + Intronic
1201910814 Y:19132048-19132070 TATCCAGAGTTGGTTGCTTCTGG - Intergenic