ID: 1094560456

View in Genome Browser
Species Human (GRCh38)
Location 12:31548001-31548023
Sequence CAGCCTCTAAAAAGTTTTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 356
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 323}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094560450_1094560456 15 Left 1094560450 12:31547963-31547985 CCCAAAGTGCTGGGACTGAAGGT 0: 1
1: 110
2: 3826
3: 93972
4: 339162
Right 1094560456 12:31548001-31548023 CAGCCTCTAAAAAGTTTTAAAGG 0: 1
1: 0
2: 2
3: 30
4: 323
1094560451_1094560456 14 Left 1094560451 12:31547964-31547986 CCAAAGTGCTGGGACTGAAGGTG 0: 1
1: 100
2: 3514
3: 85946
4: 229840
Right 1094560456 12:31548001-31548023 CAGCCTCTAAAAAGTTTTAAAGG 0: 1
1: 0
2: 2
3: 30
4: 323
1094560445_1094560456 28 Left 1094560445 12:31547950-31547972 CCAACCTCGGCTTCCCAAAGTGC 0: 1396
1: 43922
2: 194289
3: 270116
4: 179323
Right 1094560456 12:31548001-31548023 CAGCCTCTAAAAAGTTTTAAAGG 0: 1
1: 0
2: 2
3: 30
4: 323
1094560447_1094560456 24 Left 1094560447 12:31547954-31547976 CCTCGGCTTCCCAAAGTGCTGGG 0: 3727
1: 127451
2: 269477
3: 209897
4: 127192
Right 1094560456 12:31548001-31548023 CAGCCTCTAAAAAGTTTTAAAGG 0: 1
1: 0
2: 2
3: 30
4: 323

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094560456 Original CRISPR CAGCCTCTAAAAAGTTTTAA AGG Intronic
902460906 1:16576007-16576029 CAGCATCTATCTAGTTTTAAAGG - Intronic
902558541 1:17261360-17261382 CAGCCTCTAATTAGTCCTAAGGG + Intronic
903896222 1:26606980-26607002 CAGCCTCTAAAAAAATTTATGGG + Intergenic
905219568 1:36435442-36435464 CAGTCTCTAAACTTTTTTAAAGG + Intronic
905235795 1:36547014-36547036 CAGCCTCTAGAAACTTGCAAAGG + Intergenic
907513023 1:54976502-54976524 TAGCCTCTAAAAAGTTTTATTGG - Intergenic
909354655 1:74694828-74694850 TAGGCTGTTAAAAGTTTTAAAGG + Intergenic
909534700 1:76723518-76723540 CAGTCAGTAAAAATTTTTAATGG + Intergenic
909803195 1:79840609-79840631 CTCTCTCTCAAAAGTTTTAAAGG - Intergenic
910340648 1:86183138-86183160 CATCTTCTAAAAATTTTAAATGG - Intergenic
910500682 1:87886793-87886815 CTGGCTCTCAAAAGTCTTAATGG + Intergenic
910569141 1:88681088-88681110 CACACTTGAAAAAGTTTTAATGG - Intergenic
910750933 1:90629356-90629378 CATGCTCTAAAAAGTTTTCAAGG + Intergenic
910906193 1:92181969-92181991 CTGCAACTAAAAAGTTTAAAAGG + Exonic
910944874 1:92579465-92579487 CAGCCTATAAAAAATATCAATGG + Intronic
913543138 1:119841126-119841148 CAGCATCTATTTAGTTTTAAAGG - Intergenic
913603004 1:120439928-120439950 CAGCATCTATCTAGTTTTAAAGG + Intergenic
913603752 1:120446280-120446302 CAGCATCTATCTAGTTTTAAAGG + Intergenic
913613860 1:120536087-120536109 CAGCATTTAATAAGTTTTAATGG + Intergenic
913640618 1:120808997-120809019 CAGCATCTATCTAGTTTTAAAGG + Intronic
913641387 1:120815281-120815303 CAGCATCTATCTAGTTTTAAAGG + Intronic
913977388 1:143472882-143472904 CAGCCTAAAAGCAGTTTTAATGG + Intergenic
914045184 1:144085558-144085580 CAGCCTATAAAAAGTCTTCAGGG - Intergenic
914071792 1:144298513-144298535 CAGCCTAAAAGCAGTTTTAATGG + Intergenic
914107363 1:144667843-144667865 CAGCCTAAAAGCAGTTTTAATGG - Intergenic
914132926 1:144875128-144875150 CAGCCTATAAAAAGTCTTCAGGG + Intergenic
914211908 1:145587627-145587649 CAGCATCTATCTAGTTTTAAAGG - Intergenic
914277859 1:146141344-146141366 CAGCATCTATCTAGTTTTAAAGG - Intronic
914364183 1:146963547-146963569 CAGCATCTATCTAGTTTTAAAGG + Intronic
914364950 1:146969834-146969856 CAGCATCTATCTAGTTTTAAAGG + Intronic
914373090 1:147047917-147047939 CAGCACTTAATAAGTTTTAATGG + Intergenic
914487499 1:148123593-148123615 CAGCATCTATCTAGTTTTAAAGG - Intronic
914538904 1:148592292-148592314 CAGCATCTATCTAGTTTTAAAGG - Intronic
914576407 1:148974807-148974829 CAGCATTTAATAAGTTTTAATGG - Intronic
914587062 1:149072458-149072480 CAGCATCTATCTAGTTTTAAAGG - Intronic
914587843 1:149078747-149078769 CAGCATCTATCTAGTTTTAAAGG - Intronic
914627775 1:149479332-149479354 CAGCATCTATCTAGTTTTAAAGG + Intergenic
915705959 1:157844033-157844055 CAGCTTCTAAAAAGTGGTAAAGG + Intronic
916310951 1:163398366-163398388 GAGCCTCTAAACAGTTGTACTGG + Intergenic
917141305 1:171838764-171838786 CAGCCTCTAGAAAGTGGAAAAGG - Intergenic
917727044 1:177838116-177838138 CAGCCACGAAAAAGAGTTAAAGG - Intergenic
917884434 1:179369376-179369398 CAGCCTAAAAAAATTTTTTAAGG - Intronic
919249709 1:195037546-195037568 GATACTCTAAAAACTTTTAAAGG - Intergenic
919349998 1:196439228-196439250 CAGCCTATAACAATTCTTAAAGG - Intronic
919371715 1:196736486-196736508 GAGCCTTTAGAATGTTTTAATGG - Intronic
919483653 1:198119937-198119959 GAGCCTTTAAAAGGCTTTAAAGG - Intergenic
922319115 1:224469868-224469890 CAGACTTTAAAAAATATTAAAGG - Intronic
923781798 1:237031548-237031570 AAGCCTCTAAATGGTTGTAAAGG - Intergenic
923968169 1:239167784-239167806 CAGCCTCTGATAACTTTTTATGG - Intergenic
924011428 1:239669252-239669274 GAGCGTATAAAAAGTTTAAAAGG - Intronic
924600638 1:245485682-245485704 CAGCATTTAAAAACTTTTGAAGG - Intronic
1064433299 10:15289799-15289821 CAGTGTCTATAAAGTTTTATTGG + Intronic
1066367248 10:34789124-34789146 CGACCTCTAAAAAGTATTATGGG + Intronic
1066420655 10:35261698-35261720 CAATCTCTAAAAAAATTTAACGG + Intronic
1066957300 10:42185251-42185273 CAGCCTATAAAAATTCTTCAGGG - Intergenic
1066994182 10:42548467-42548489 CAGTGTCTATAAAGTTTTATCGG - Intergenic
1068433407 10:56961536-56961558 GAGCTCTTAAAAAGTTTTAAAGG + Intergenic
1069079850 10:64077157-64077179 CAGTATCTATAAAGTTTTATTGG - Intergenic
1071580329 10:86763224-86763246 CAGCTTTTTAAAAATTTTAAAGG + Intronic
1074198117 10:111207229-111207251 CAGCCTCTAAACTCCTTTAAGGG + Intergenic
1075110841 10:119582049-119582071 CAGCCACTAAAACCTTTTTAAGG + Intronic
1075933910 10:126323442-126323464 CAGCCTCCAAATGATTTTAAAGG + Intronic
1076204417 10:128585101-128585123 CATCATCTACAAAGTTTTGAGGG - Intergenic
1079069617 11:17332715-17332737 CTGTCTCTAAAAAATTTAAAAGG - Intronic
1080068683 11:28052074-28052096 CAGATTCTAAAATGTTTTGAAGG - Intronic
1080667301 11:34346935-34346957 CAGACTAAAAAAAGTTGTAAAGG + Intronic
1082752249 11:57031632-57031654 CAGGGTCTAAAAAGTCTTATAGG + Intergenic
1085060865 11:73445560-73445582 CAGCCTTTAAAAACTCTTATTGG + Intronic
1086459150 11:86988190-86988212 CTGCCTCCAAAAAGATGTAATGG - Intergenic
1086594312 11:88552880-88552902 AAGCCTCTAAAAATTTCCAAGGG + Intronic
1089042492 11:115465771-115465793 CAGCCTCTATAACTTTTTACAGG + Intronic
1089042493 11:115465774-115465796 CTGCCTGTAAAAAGTTATAGAGG - Intronic
1089121731 11:116140770-116140792 CAGCCTCTAAAACGTGGAAAAGG - Intergenic
1091815410 12:3434178-3434200 CAGTCCCTAAAGGGTTTTAATGG - Intronic
1092898844 12:13039674-13039696 TAGACTCTAGAAAGTTTTATAGG + Intergenic
1093120916 12:15270551-15270573 CAGCCTCTAAAAACTGGAAAAGG + Intronic
1093684218 12:22038205-22038227 CAGCCTCTAAAAGCTTGAAAAGG - Intergenic
1094375901 12:29786786-29786808 TAGCCTCTAATTATTTTTAAAGG + Intergenic
1094560456 12:31548001-31548023 CAGCCTCTAAAAAGTTTTAAAGG + Intronic
1096482689 12:51952535-51952557 CAGGCTCCAAAAAGGTTTAGGGG - Intronic
1097046377 12:56189964-56189986 GAGACTCTGAAAAGTTTAAATGG - Intergenic
1097407535 12:59209240-59209262 AAGCCTCGAAAAAGTCTTAGAGG + Intergenic
1097421738 12:59389691-59389713 CACCCTATAAAATTTTTTAAAGG - Intergenic
1097436344 12:59554634-59554656 CAGCCTCTAAGAAGATTAAAGGG - Intergenic
1097833377 12:64249364-64249386 CAGTGTCTATAAAGTTTTATTGG + Intergenic
1097873962 12:64626110-64626132 CAGCCAATTAAAAATTTTAAAGG - Intronic
1099182649 12:79485768-79485790 CAGCCCCTAAGAACTTTGAAGGG + Intergenic
1099492699 12:83306563-83306585 AAGTCTCTAAGAAGTTTCAAAGG - Intergenic
1099728831 12:86470965-86470987 CAGCATCTCAAAAGTACTAAAGG + Intronic
1100133295 12:91522441-91522463 CAGCCACTAAAAAATTCTCAAGG + Intergenic
1100772259 12:97936318-97936340 ATCCCTCTAAAAATTTTTAAAGG + Intergenic
1102656477 12:114486168-114486190 CAGGCTGTAAAAAGATTCAAAGG - Intergenic
1106214908 13:27688126-27688148 CAGTCTTCAAAAATTTTTAAGGG + Intergenic
1106631597 13:31479845-31479867 CAGCCTGTATTCAGTTTTAATGG - Intergenic
1107093172 13:36505160-36505182 CAGCCCCAAATAAGTTTAAAGGG - Intergenic
1107434413 13:40369621-40369643 CAGCCTGCAAAAAGTCTTTAGGG - Intergenic
1108524041 13:51270576-51270598 CAGCACCTCAAAAGTTTCAAGGG - Intronic
1109761963 13:66842451-66842473 AAGCCTAAAAAAAGTTTCAAAGG - Intronic
1110385677 13:74907490-74907512 GAGCCACTAAATTGTTTTAATGG - Intergenic
1111827366 13:93284337-93284359 AAGCCTCTAAAAGGACTTAAAGG - Intronic
1115044695 14:28977229-28977251 CAGCCTCTAGAAACTGTAAAAGG + Intergenic
1117130512 14:52682090-52682112 CTGCCTTTAAAAAGTTGTAATGG + Intronic
1117254882 14:53967743-53967765 CAGCCTCTAGAAAGTGGAAAAGG - Intergenic
1117306108 14:54474976-54474998 CATCCTCACAAAAGTTGTAATGG + Exonic
1117364077 14:55007910-55007932 CAGCCTAATAAAGGTTTTAAAGG - Intronic
1118580135 14:67287767-67287789 CAGCATTTTAAAAGTTTGAAAGG + Intronic
1118852526 14:69595023-69595045 CAGCCTCTCAACAGCTTTCAGGG - Intergenic
1118906085 14:70024297-70024319 CAGCCTTGAAAAACTTTTGAAGG + Intronic
1119035250 14:71224924-71224946 CTTTCTCTAAAAAGATTTAAAGG - Intergenic
1119937602 14:78607096-78607118 CAGCCTTTGATAAGTTTTAGAGG + Intronic
1121295004 14:92813392-92813414 CAGCCTCAGGCAAGTTTTAAGGG - Intronic
1121643823 14:95504153-95504175 CAGTGTCTATAAAGTTTTATTGG + Intergenic
1122519237 14:102331545-102331567 CGGCCACTAAAAGGTTTTTATGG + Intronic
1122591250 14:102853199-102853221 CAGCCTCTAAAAAAAAATAAAGG - Intronic
1202935800 14_KI270725v1_random:86529-86551 CAGCCTATAAAAAGTCTTCAGGG + Intergenic
1124505371 15:30268027-30268049 CAACTCATAAAAAGTTTTAAAGG - Intergenic
1124738181 15:32270604-32270626 CAACTCATAAAAAGTTTTAAAGG + Intergenic
1124879012 15:33624444-33624466 GAGCCTTTAAAAAGCTTAAATGG + Intronic
1126032573 15:44513799-44513821 CAGAATGTAAATAGTTTTAATGG + Intronic
1126804041 15:52327851-52327873 CAGCATCAAAAAAGTATTGAAGG - Exonic
1127667934 15:61167442-61167464 CATCCTTTAAAGAGTTCTAAAGG - Intronic
1128950091 15:71870417-71870439 ATGACTCTAAAAAGTCTTAAAGG - Intronic
1129085861 15:73091111-73091133 CAGTCACTAAAAAATTGTAAAGG - Intronic
1130705349 15:86228043-86228065 CAGCCTATCAAAAGTATTGATGG + Intronic
1131722200 15:95182096-95182118 CTTCCTCTAAAAATTTTTATTGG - Intergenic
1135870476 16:26145262-26145284 CAGCCTCTAAAGACATTTAATGG - Intergenic
1138058466 16:53861952-53861974 CAGCCTCTACAGAGTTTTAAGGG - Intronic
1140099450 16:71902710-71902732 CAGATTCTAAAGACTTTTAAAGG - Intronic
1140965845 16:79965259-79965281 CAGCCAAGAGAAAGTTTTAAAGG - Intergenic
1141005094 16:80344591-80344613 CAGTCTCTAAAATGCTTTGATGG - Intergenic
1148227456 17:45908916-45908938 CAGCCTATAAATTGTATTAAGGG + Intronic
1148375397 17:47140160-47140182 CAATCTCTTAAAAGTTATAAAGG + Intronic
1148634917 17:49141649-49141671 CATGCTCTCGAAAGTTTTAAGGG - Intronic
1148757519 17:49981327-49981349 CAGCCTTTATAAAGTCTTCATGG + Intergenic
1149054770 17:52350335-52350357 GAGCCTCTATAAAGATTAAATGG - Intergenic
1149158487 17:53662936-53662958 CAGCCTCTAAACTGCTTTCAGGG - Intergenic
1153003090 18:474107-474129 CAGCATCCCAAAATTTTTAATGG - Intronic
1154336009 18:13465377-13465399 GAGCCTTTAAGAAGTTATAAAGG - Intronic
1156037332 18:32779708-32779730 CAGCCTCTGGGAAGTTTTCAAGG - Intergenic
1156772584 18:40747648-40747670 AAACTTCTAAAAAGTTTGAAAGG - Intergenic
1157853281 18:51078763-51078785 AAGGCTCTAAGACGTTTTAAAGG - Exonic
1158290850 18:55940598-55940620 CAACCTCTGAATAGTTCTAATGG + Intergenic
1159100730 18:63955618-63955640 CACCCTTCCAAAAGTTTTAAAGG - Intronic
1160202762 18:76809032-76809054 CATCCTTTAAAAAGTTATTAAGG + Intronic
1164310337 19:24040618-24040640 AAGCCTCAAAAAATTTTGAAAGG - Intronic
1164404575 19:27932769-27932791 CAGCTTTTAAAACATTTTAATGG - Intergenic
1167329497 19:48846154-48846176 CAGCCTTAAAAAGTTTTTAAGGG - Intronic
1202653227 1_KI270707v1_random:25390-25412 AAGCTTCTAAAAAGATTTAGAGG + Intergenic
1202684742 1_KI270712v1_random:38962-38984 CAGCCTATAAAAAGTCTTCAGGG - Intergenic
929340673 2:40813030-40813052 CAGACTTTAAAAAGATTAAATGG - Intergenic
931517238 2:63057041-63057063 CAGCAACTAAAAAGTTTAAGTGG - Exonic
932075454 2:68658462-68658484 CAGATGCTAAAAAGTATTAATGG - Intergenic
933235645 2:79861455-79861477 CAGCCTCTAAAAATGAGTAAAGG + Intronic
933428343 2:82142032-82142054 CATCCTCTAAAATGTTTATATGG + Intergenic
933494388 2:83030108-83030130 TAGACTTTAAAAAGATTTAATGG + Intergenic
934182095 2:89633880-89633902 CAGCCTAAAAGCAGTTTTAATGG + Intergenic
934246976 2:90315884-90315906 CAGCCTATAAAAAGTCTTCAGGG + Intergenic
934262349 2:91486719-91486741 CAGCCTATAAAAAGTCTTCAGGG - Intergenic
934292393 2:91708088-91708110 CAGCCTAAAAGCAGTTTTAATGG + Intergenic
934305399 2:91817708-91817730 CAGCCTATAAGAAGTCTTCAGGG - Intergenic
934327857 2:92035040-92035062 CAGCCTATAAGAAGTCTTCAGGG + Intergenic
934466248 2:94265579-94265601 CAGCCTATAAGAAGTCTTCAGGG + Intergenic
935447687 2:103174059-103174081 CACCCTTTGAAAAGTTCTAATGG + Intergenic
936344337 2:111663676-111663698 GAGCCTCTGAACAGTTGTAAGGG - Intergenic
939009836 2:136833050-136833072 CATACTCTAATAAGTTTAAAAGG + Intronic
939518181 2:143195597-143195619 CAGTCTCTTAAAAGTTTTTTTGG - Intronic
939646894 2:144711067-144711089 AAGGCTCTGACAAGTTTTAAAGG + Intergenic
939727053 2:145734027-145734049 CAAACTCTACAAAATTTTAAAGG + Intergenic
940065768 2:149626836-149626858 CATCTTATAAAAAGTTTTGAAGG + Intergenic
941497527 2:166224625-166224647 TACCCTCTAAAATGTTTTAATGG + Intronic
941911298 2:170767639-170767661 AAGCCTCAAAACATTTTTAATGG - Intergenic
942232065 2:173869671-173869693 CTGACTCCAAAAAGTTATAAAGG - Intergenic
942236571 2:173914346-173914368 CAGGCTATAGAAAGTTTTACAGG - Intronic
942363252 2:175195299-175195321 AAGCCTTAAAAAAGTTTTACTGG - Intergenic
942637295 2:178021257-178021279 CAGCCTCCATTAAGTCTTAATGG + Intronic
943044710 2:182846533-182846555 CAGTCTTGAAAAAGTTATAAAGG - Intronic
944931920 2:204528603-204528625 CAGCCTCTAGAAACTGTAAAAGG + Intergenic
946050838 2:216861030-216861052 CATCCTCTTAACATTTTTAAAGG - Intergenic
946097619 2:217289323-217289345 CAGCCTCTGCAAAGTTATCATGG - Intronic
1169742199 20:8907186-8907208 CAACATTTTAAAAGTTTTAAAGG + Intronic
1170521232 20:17187628-17187650 CAGCCTCTGTAAACTTTAAAGGG + Intergenic
1174757227 20:53171600-53171622 CACCCTCACAAAAATTTTAAAGG - Intronic
1176598928 21:8774264-8774286 AAGCTTCTAAAAAGATTTAGAGG - Intergenic
1176730374 21:10489355-10489377 CAGCCTAAAAGCAGTTTTAATGG - Intergenic
1177815571 21:25972696-25972718 CAGTCTCTAAGACATTTTAAAGG + Intronic
1178350635 21:31871021-31871043 CAGGCTTGAAAAAGATTTAATGG + Intergenic
1179968971 21:44823967-44823989 CAGTATCTAAAAAGTGGTAAAGG + Intergenic
1180280147 22:10686205-10686227 CAGCCTATAAAAAGTCTTCAGGG + Intergenic
1180419510 22:12800641-12800663 AAGCTTCTAAAAAGATTTAGAGG + Intergenic
1180587370 22:16904737-16904759 CAGCCTATAAAAAGTCTTCAGGG + Intergenic
951329461 3:21348465-21348487 CAGCCTCCAATAAGTTTTCATGG - Intergenic
952866716 3:37860302-37860324 GAGCCTCTCCAAAGTATTAAAGG - Intergenic
955024895 3:55157991-55158013 CAGCCTCTCAAGAGAGTTAAGGG + Intergenic
956547010 3:70415688-70415710 GAGCATCTAAAAATTTTTCAAGG - Intergenic
956807157 3:72826954-72826976 CAGCCTGGAAAATGATTTAAAGG + Intronic
956938197 3:74127904-74127926 AAGCCTATAAAAGGTTTAAAAGG - Intergenic
957698945 3:83684265-83684287 CAGCATTTAAAAAATTTAAAGGG - Intergenic
957983846 3:87546990-87547012 CAGCAACTAAAATGTTTGAAGGG + Intergenic
958872128 3:99572388-99572410 CTGCATCTTATAAGTTTTAACGG + Intergenic
959628235 3:108478212-108478234 CAGCCTTTAAAATGTTTACAAGG + Intronic
959934190 3:112012664-112012686 CAACCTCTCAGAAGTTTTCAGGG - Intronic
960860164 3:122143681-122143703 CAGCCTCCAAAAAGATTGAATGG - Intergenic
961614801 3:128170263-128170285 CAGCCTCAAGAAAGCTTTAAAGG - Intronic
962549397 3:136474249-136474271 AAGTCTCTCAAAAGATTTAAAGG + Intronic
963102589 3:141621190-141621212 CAGCCTCAAAAAATTTTTGTTGG + Intergenic
963348532 3:144125226-144125248 AAGTGTCTAAAAAGTGTTAAAGG + Intergenic
963392312 3:144681081-144681103 CATTCTCAAATAAGTTTTAAAGG - Intergenic
965088253 3:164127767-164127789 GAGCCTCTAAGAATTTTCAAAGG - Intergenic
965694177 3:171389911-171389933 CAGCCTCAAAATAGATGTAATGG - Intronic
965971121 3:174557949-174557971 GAGCCTCTAAGAAGTTTCACTGG - Intronic
967083171 3:186069747-186069769 CAGCCTCTCAAAAGTTTGCTGGG + Intronic
967139056 3:186538113-186538135 AAGCCCCTGAAAATTTTTAAAGG - Intergenic
967836153 3:193964817-193964839 TAGCCTCCAAAAAGTATCAAGGG + Intergenic
967905286 3:194494579-194494601 CAGCCTCAAAGTACTTTTAATGG - Intronic
968400937 4:296916-296938 CAGCCTCTGTAAACTTTAAACGG - Intronic
968866359 4:3215009-3215031 CAGCCTCACAAAAGTTGAAAGGG - Intronic
970370617 4:15402214-15402236 CAACCTCTACCAAGTTCTAAGGG + Intronic
970934346 4:21550939-21550961 GACCCTCTAAAGCGTTTTAAAGG - Intronic
971062288 4:22985799-22985821 CAGCCTCAGAAAAGTAATAAAGG - Intergenic
972218019 4:36918835-36918857 CAGCCTGCAAAAAGCTTCAAGGG - Intergenic
973362272 4:49176632-49176654 AAGCTTCTAAAAAGATTTAGAGG - Intergenic
973398822 4:49620228-49620250 AAGCTTCTAAAAAGATTTAGAGG + Intergenic
973621641 4:52732425-52732447 CAGCTTTTAAAAAGTTCTGAAGG + Intronic
973641432 4:52906476-52906498 CAGCCTCTCCAAAGTGTTTAGGG - Intronic
973690569 4:53425032-53425054 TTGCTTCTATAAAGTTTTAAAGG + Intronic
975863014 4:78697788-78697810 CTGGCTCAAAAAACTTTTAAAGG + Intergenic
978299614 4:107252294-107252316 CTGCCTCTAAAAAGTTGTTCTGG - Intronic
980747535 4:137038301-137038323 AAGCTTCTTAAAAATTTTAAAGG + Intergenic
980994279 4:139765533-139765555 CAGCCTCTGAAGTATTTTAAGGG + Intronic
981811045 4:148775068-148775090 TAGACTATAAAAAGTTTTATGGG - Intergenic
982119689 4:152130359-152130381 CATCCATTAAAAAATTTTAAAGG - Intergenic
982346149 4:154362367-154362389 CAGCCTCTTAAAAATTTCATGGG - Intronic
983096347 4:163566669-163566691 AAGCCTATAAATAGTTTAAAGGG + Intronic
983432743 4:167672076-167672098 CAACCTCTAGAAAGTTTATATGG - Intergenic
984927938 4:184822992-184823014 GGGCTTCTGAAAAGTTTTAAAGG - Intronic
985917786 5:2937769-2937791 AAGCCTCAATAAATTTTTAAAGG + Intergenic
985994385 5:3589326-3589348 GAGCCTCTCAAAAGTTGTCATGG + Intergenic
988115994 5:26891852-26891874 CAGCCTCTAAAAACTAGGAATGG + Intronic
989381588 5:40814169-40814191 CAACCTCCAAAATGTTTTATGGG + Intergenic
989645360 5:43625970-43625992 CAGCCACTAAAAATATTTATAGG - Intronic
990750278 5:59007476-59007498 CTGCCTCTAAAATATTTTTAAGG - Intronic
991126359 5:63073969-63073991 AAGCATTTAAAATGTTTTAAGGG + Intergenic
991316573 5:65315330-65315352 CAGCAACTAAAATATTTTAAAGG + Intronic
991769474 5:70027056-70027078 CAGCCTATAAAAAGTTCTTATGG - Intronic
991848769 5:70902474-70902496 CAGCCTATAAAAAGTTCTTATGG - Intronic
991901021 5:71460702-71460724 AAGCCTCTAAAAATGTTTTATGG + Intronic
992258581 5:74947405-74947427 AAGACTCTAAAAGGTTTGAAAGG - Intergenic
992836220 5:80644187-80644209 CAGCCACTAAAAATATTTACAGG + Intronic
993819759 5:92600293-92600315 CAGCCTCTACAAATTTCTCATGG - Intergenic
994260358 5:97651444-97651466 CATCCTCCCAAGAGTTTTAAAGG + Intergenic
994420149 5:99521549-99521571 CAGCCTATAAAAAGAGCTAATGG + Intergenic
994487059 5:100393591-100393613 CAGCCTATAAAAAGAGCTAATGG - Intergenic
994769259 5:103960925-103960947 CAGCCTATAAACACTCTTAACGG - Intergenic
995154616 5:108895484-108895506 CAGCCTCTAAAAACTGGAAAAGG - Intronic
996026183 5:118648475-118648497 ATGCCTCTAACAAGTTTTTAAGG - Intergenic
996499115 5:124197036-124197058 CAACATCAAAAGAGTTTTAATGG - Intergenic
997135541 5:131321334-131321356 CTGCCTCTTTTAAGTTTTAAAGG - Intronic
997237107 5:132279015-132279037 GAACCTCTAAAAAGGTTTAAGGG + Intronic
997710964 5:136004331-136004353 CAGGCTTTAGAAAGTTTTGAAGG - Intergenic
997847599 5:137302270-137302292 CAGCCTATAAACTGATTTAAAGG - Intronic
997924693 5:138018745-138018767 CAGCCTAGAACAAGTTTTAGTGG - Intronic
998684332 5:144506552-144506574 CTGCCTTTGCAAAGTTTTAATGG + Intergenic
998806766 5:145924820-145924842 CCCCCTCTTAAAAGTTTTACAGG + Intergenic
1002143824 5:177162681-177162703 CAGCCTCAAAAAAGCTATAATGG - Intronic
1002910287 6:1486003-1486025 AAGCTTTCAAAAAGTTTTAATGG + Intergenic
1003665382 6:8106888-8106910 ATGCCTCTAAAAATTTTTAGAGG + Intergenic
1003665383 6:8106891-8106913 AGGCCTCTAAAAATTTTTAGAGG - Intergenic
1003893710 6:10586602-10586624 CAGCATCTGAAAGGATTTAAAGG + Intronic
1008153343 6:47983295-47983317 TATGATCTAAAAAGTTTTAATGG + Intronic
1008617313 6:53239088-53239110 CAACAGATAAAAAGTTTTAAGGG + Intergenic
1008793291 6:55266673-55266695 CAACCTTGAAAGAGTTTTAAAGG - Intronic
1009430722 6:63562969-63562991 CTGCCTCTAAAAATTGTCAAAGG - Intronic
1011113470 6:83864058-83864080 CAGCCTCTTAAAACTGTAAAAGG + Intronic
1011470914 6:87706636-87706658 AAGCCTGTAACAAGTTTTAAAGG + Intergenic
1011819028 6:91229166-91229188 AAACTTCTAAAAAGTTCTAAAGG - Intergenic
1012080076 6:94746277-94746299 CAAACTCTAAAAATTTTTTAAGG + Intergenic
1012875792 6:104724221-104724243 CAGAGTGTAAAAAGTTATAAAGG - Intergenic
1013732410 6:113184298-113184320 CAGGCTCTAAGAAGTTTCTAAGG - Intergenic
1014839772 6:126204981-126205003 ATGCCTCTAAATATTTTTAAAGG - Intergenic
1017132768 6:151122241-151122263 AAGCCTCTACTCAGTTTTAAAGG + Intergenic
1019780909 7:2939120-2939142 CAGCATCTAAAAAGTGTTTCGGG - Intronic
1020067402 7:5199337-5199359 CAGCCTCAGAAAAGTTTTATAGG + Intronic
1021175417 7:17444319-17444341 CAGGCTGGAAAATGTTTTAATGG + Intergenic
1021610704 7:22455158-22455180 CAGCCTTAAAAATATTTTAAAGG + Intronic
1022191870 7:28024341-28024363 CAGCATATTAAAAGTTCTAAGGG + Intronic
1023769692 7:43545091-43545113 CCATCTCTAAAAATTTTTAAAGG + Intronic
1024352012 7:48376190-48376212 AATACTTTAAAAAGTTTTAAAGG - Intronic
1024355157 7:48406964-48406986 CAGCCACTAAAAAGTCATCAAGG + Intronic
1025078075 7:55960467-55960489 CCGTCTCTAAAATATTTTAAAGG + Intronic
1027823135 7:83074548-83074570 CAGCCATTAAAATCTTTTAAAGG + Intronic
1028045727 7:86116739-86116761 GGGCCTCTAACAAGTTTTGAGGG - Intergenic
1028122704 7:87074077-87074099 CAGCATCTAAAAATTTTGACAGG - Intergenic
1028593404 7:92522952-92522974 CAGCCTCTTAATAATTGTAAGGG + Intronic
1028921875 7:96318652-96318674 CTTCCTTTAAATAGTTTTAATGG - Intronic
1029254622 7:99261240-99261262 CAGCCTCTTTCAAGTCTTAATGG + Intergenic
1029675268 7:102064343-102064365 CCGGCTCTAAATGGTTTTAAGGG + Intronic
1030058629 7:105605235-105605257 CAGCCTATAAAACATTTTTAGGG - Exonic
1030479788 7:110088529-110088551 CACCATTTAAAAAGTTTTACAGG + Intergenic
1031169415 7:118273534-118273556 AAGGCTGTAAAAAATTTTAAGGG - Intergenic
1032450904 7:132030002-132030024 CAGCATTTAAAAAGATTCAATGG + Intergenic
1032589801 7:133181447-133181469 CAGCCTAAATAAAGTTTTATTGG + Intergenic
1032692840 7:134305964-134305986 CAGCCCCTGACCAGTTTTAATGG + Intronic
1034000237 7:147403571-147403593 CAGACTCTACACTGTTTTAATGG + Intronic
1034483185 7:151339466-151339488 TAGCTTCTAAAAAGTTGTAGAGG + Intergenic
1034985132 7:155507898-155507920 AAGACTCTAAAAATGTTTAATGG + Intronic
1035709292 8:1700200-1700222 CAGCCTCTGAAAAATTCCAAAGG - Intronic
1039089067 8:33809167-33809189 CTTCCTCTATAAAGTTTCAAAGG + Intergenic
1039156793 8:34568734-34568756 CAGCCTCTCTATTGTTTTAAGGG + Intergenic
1040507467 8:48062911-48062933 TAGTCTTTAAAAATTTTTAATGG + Exonic
1041532942 8:58892260-58892282 CAGGATGTACAAAGTTTTAAAGG + Intronic
1041867064 8:62586066-62586088 CTGCCTTTAAAAATTTGTAAAGG + Intronic
1043535032 8:81193465-81193487 CTGCCTCTAAAAAGGTTGAATGG - Intergenic
1045109221 8:98924138-98924160 CAGCCTCCACAAAATTTTCAGGG - Intronic
1045831134 8:106461635-106461657 CAGGCTTAAAATAGTTTTAAAGG - Intronic
1045956753 8:107917186-107917208 TGGCCTCAAAAAAATTTTAAAGG - Intronic
1049848539 8:144818109-144818131 AAGCCTCTAAAAAACATTAATGG + Intergenic
1050556176 9:6791436-6791458 CAGCCTCTAGACAGTTTGGAAGG + Intronic
1052844342 9:33321900-33321922 CAGCCTCCAGAAACTTTAAATGG - Intronic
1053251912 9:36581418-36581440 TATTCTTTAAAAAGTTTTAAAGG + Intronic
1053341895 9:37343923-37343945 CAGTGTCTATAAAGTTTTATTGG - Intronic
1053658340 9:40243695-40243717 GTGCCTATGAAAAGTTTTAAGGG + Intronic
1053696297 9:40642351-40642373 CAGCCTATAAGAAGTCTTCAGGG + Intergenic
1053908712 9:42872969-42872991 ATGCCTATGAAAAGTTTTAAGGG + Intergenic
1054307548 9:63441579-63441601 CAGCCTATAAGAAGTCTTCAGGG + Intergenic
1054370464 9:64389970-64389992 GTGCCTATGAAAAGTTTTAAGGG + Intronic
1054406276 9:64765581-64765603 CAGCCTATAAGAAGTCTTCAGGG + Intergenic
1054439904 9:65251054-65251076 CAGCCTATAAGAAGTCTTCAGGG + Intergenic
1054490502 9:65770885-65770907 CAGCCTATAAGAAGTCTTCAGGG - Intergenic
1054526258 9:66132526-66132548 GTGCCTATGAAAAGTTTTAAGGG - Intronic
1054678091 9:67879725-67879747 GTGCCTATGAAAAGTTTTAAGGG + Intronic
1055294749 9:74822550-74822572 TAGACTCTATAAACTTTTAATGG + Intronic
1059792170 9:117651859-117651881 TAGTCTATAAACAGTTTTAAAGG - Intergenic
1060373870 9:123101156-123101178 CAGCCTCTAAAAGGTTTTTGAGG - Intronic
1061624260 9:131831947-131831969 CAGTGTCTATAAAGTTTTATTGG + Intergenic
1061966820 9:134019387-134019409 CTATCTCAAAAAAGTTTTAAGGG - Intergenic
1202778745 9_KI270717v1_random:16012-16034 CAGCCTATAAGAAGTCTTCAGGG + Intergenic
1203583909 Un_KI270746v1:44713-44735 CAGCCTAAAAGCAGTTTTAATGG + Intergenic
1203585822 Un_KI270747v1:2420-2442 CAGCCTATAAGAAGTCTTCAGGG + Intergenic
1186333315 X:8559743-8559765 GAGCCTCTGAGAAGTTTTCATGG - Intronic
1187177133 X:16906017-16906039 CTGTCTGAAAAAAGTTTTAATGG + Intergenic
1187568803 X:20479413-20479435 CAGGCCCTGAAAAATTTTAAAGG + Intergenic
1187721874 X:22159603-22159625 CAGTGTCTATAAAGTTTTATTGG + Intronic
1188245333 X:27830916-27830938 CAGCCTCTAATAAGAGTGAAAGG + Intergenic
1188383305 X:29525330-29525352 CAGCTTCTAGACAGTTTCAATGG - Intronic
1189264316 X:39702036-39702058 CATCCTCTAGAAAGTTGAAAAGG + Intergenic
1189580750 X:42403858-42403880 CTGCCTCTAAAAATTTTAAAGGG + Intergenic
1190005394 X:46731872-46731894 TATCTTCTTAAAAGTTTTAAGGG - Intronic
1193168612 X:78310430-78310452 GAGCATCTAGAAAGTTTTTAGGG - Intronic
1194456614 X:94111883-94111905 TTTCCTTTAAAAAGTTTTAAAGG + Intergenic
1194465919 X:94235365-94235387 CAGCCTTTAAAATATTTTCAAGG + Intergenic
1196203464 X:112912361-112912383 CAACCTAAAAAAAATTTTAAAGG + Intergenic
1196404920 X:115350984-115351006 CAGCCTCTTGAATTTTTTAAGGG - Intergenic
1198205581 X:134461262-134461284 CTGCCCTTAAAAAGTTTTAGTGG - Intronic
1198671432 X:139084820-139084842 GAGCCAATAAAAAGTATTAAAGG - Intronic
1199360654 X:146914209-146914231 CAGCCTAAATAAAATTTTAAAGG - Intergenic
1201194045 Y:11474280-11474302 CAGCCTATAAAAAGTCTTCAGGG + Intergenic