ID: 1094561653

View in Genome Browser
Species Human (GRCh38)
Location 12:31560194-31560216
Sequence AAACTCAGAATGTCCAAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 436
Summary {0: 1, 1: 0, 2: 9, 3: 37, 4: 389}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094561649_1094561653 30 Left 1094561649 12:31560141-31560163 CCAGACTCATACGTCTAACTGCC 0: 1
1: 0
2: 9
3: 41
4: 143
Right 1094561653 12:31560194-31560216 AAACTCAGAATGTCCAAAAATGG 0: 1
1: 0
2: 9
3: 37
4: 389
1094561650_1094561653 9 Left 1094561650 12:31560162-31560184 CCTACTTGACCAGAATATCTTAC 0: 1
1: 0
2: 1
3: 7
4: 106
Right 1094561653 12:31560194-31560216 AAACTCAGAATGTCCAAAAATGG 0: 1
1: 0
2: 9
3: 37
4: 389
1094561652_1094561653 0 Left 1094561652 12:31560171-31560193 CCAGAATATCTTACAGGTGTCTC 0: 1
1: 0
2: 0
3: 23
4: 168
Right 1094561653 12:31560194-31560216 AAACTCAGAATGTCCAAAAATGG 0: 1
1: 0
2: 9
3: 37
4: 389

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094561653 Original CRISPR AAACTCAGAATGTCCAAAAA TGG Intronic
900880893 1:5380529-5380551 AAACTCAGAATGAACAGGAAGGG + Intergenic
901009162 1:6189130-6189152 AGACTCACCATCTCCAAAAAAGG + Intronic
901029877 1:6300832-6300854 AAACACAGAATGACCAACACCGG + Intronic
901180657 1:7339505-7339527 AAACTCAGAATGGCCAAGCAGGG - Intronic
901860032 1:12068437-12068459 ACACGCAGAATGTCAAAAAAAGG + Intronic
903743091 1:25569643-25569665 GAACTCAATATGTCTAAAAATGG + Intergenic
904060196 1:27703243-27703265 AAAATAAGAATGTTCACAAAAGG - Intergenic
905272400 1:36795739-36795761 AAATTCTGCATGTCCACAAAGGG + Exonic
906333852 1:44911073-44911095 AAACGCTGAATTTCCAAAGATGG - Intronic
906800256 1:48730859-48730881 AAACTCAGACACTCCACAAAAGG + Intronic
907163192 1:52386713-52386735 AAACTTAGAAAGGCCAAGAAGGG + Intronic
907585611 1:55615293-55615315 AAACTCAGAATTTGGAAATAGGG + Intergenic
908584484 1:65553619-65553641 AAGCTAAGAATGTTGAAAAAAGG - Intronic
908723104 1:67147309-67147331 AAACTCACTATGTGAAAAAATGG - Intronic
909189789 1:72538050-72538072 TCTCTCAGAATGTCCATAAATGG - Intergenic
910720777 1:90284186-90284208 AAACTCAGAGTGTCTCACAATGG + Intergenic
911791175 1:102016910-102016932 AAAATTACTATGTCCAAAAAGGG + Intergenic
911803175 1:102169859-102169881 AAACTCACAATATCAACAAAGGG + Intergenic
912307960 1:108590060-108590082 AACCTCAAAATATCCAAAACTGG + Intronic
912671144 1:111626740-111626762 AAACTCAAAACATGCAAAAATGG - Intronic
913042129 1:115037293-115037315 TATCTCAGTATGTTCAAAAAAGG + Intergenic
914793376 1:150899148-150899170 AAACTCAAAAAGTCCAAGCATGG + Intergenic
916916240 1:169409126-169409148 AAGCTAAGAATCTTCAAAAAAGG + Intronic
918894004 1:190316162-190316184 AAGTTCAGAATGACAAAAAAAGG + Intronic
919683680 1:200460579-200460601 ACACTCAGAATTTACCAAAAAGG + Intergenic
921163046 1:212486484-212486506 ATACTCAGAATGTCCAGACAGGG - Intergenic
923166552 1:231369385-231369407 AAACTCAGGATTTCATAAAAAGG + Intronic
923657799 1:235933337-235933359 TAACTAAGAATTTCCAAGAATGG + Intergenic
923810217 1:237306849-237306871 AAACTCAGAAGGCCCAAATAAGG - Intronic
924674656 1:246163908-246163930 AAAGTCAGAATCTCCAAGAATGG + Intronic
924890353 1:248271640-248271662 AAATTCAGGATGGCCAGAAATGG + Intergenic
1063901672 10:10739430-10739452 AAAATTAAAATGCCCAAAAATGG - Intergenic
1064536971 10:16366997-16367019 AATCTCAGAATAACCAAAGAAGG - Intergenic
1065048605 10:21767026-21767048 AAACCTAGAATTTCCAGAAATGG + Intronic
1065491518 10:26286994-26287016 AAACTCAGAATCTACATAAAAGG - Intronic
1066076552 10:31883623-31883645 AAACCTTGAATGTGCAAAAATGG - Intronic
1066931023 10:41758993-41759015 AATCACAGAATGGACAAAAAGGG - Intergenic
1067393250 10:45885335-45885357 AGAATGAGAATGTCCACAAAGGG + Intergenic
1067436721 10:46283870-46283892 AAACGCAAAATGTCAAGAAAAGG + Intergenic
1067861572 10:49854463-49854485 AGAATGAGAATGTCCACAAAGGG + Intronic
1068566750 10:58584342-58584364 AACCTCAGTCAGTCCAAAAAGGG - Intronic
1068859234 10:61830021-61830043 AAACTCAAGATGGCCAAAGATGG + Intergenic
1069468646 10:68665560-68665582 AAACTTGGAATATCCAGAAAAGG + Intronic
1070274988 10:74997296-74997318 GAACACAGAATGTACAGAAAAGG + Intronic
1071892442 10:90025429-90025451 AAACTAAAATTGGCCAAAAAAGG + Intergenic
1072034422 10:91551416-91551438 AAACACAGCATGGCCAAACATGG + Intergenic
1072150385 10:92678334-92678356 AAATTCAAAAAGTACAAAAATGG + Intergenic
1072603474 10:96955298-96955320 AAACTCTGCCTTTCCAAAAATGG + Exonic
1072880107 10:99218270-99218292 AAACTCAGAATGTCAGGTAAGGG + Intronic
1078181243 11:9013185-9013207 AAAATTAGCATGTCCAATAAAGG - Intergenic
1078194315 11:9122241-9122263 AAACTCAGAATTTCTAAGAAGGG - Intronic
1078759974 11:14243965-14243987 AAACTCATCATGTCCAAAATGGG + Intronic
1079257511 11:18844951-18844973 AACCTCAGATTGTCCAGAAGGGG + Intergenic
1079292970 11:19205055-19205077 AAGTTCAGAATGTGCAAAGAGGG - Intronic
1079870223 11:25788830-25788852 CAAGTCAGAATGTCCAAAAAAGG - Intergenic
1081999215 11:47383900-47383922 AAATTCAAAAGGTACAAAAAAGG + Intergenic
1083200887 11:61120365-61120387 AAATTTAGAATGTCCAGGAATGG - Intronic
1084525681 11:69696606-69696628 AAACTCAGAATCTCCATGAGTGG + Intergenic
1085392275 11:76188611-76188633 AATCCCAGAATGTCCAAGATGGG + Intronic
1085509326 11:77079922-77079944 AAACTCAAATGGTCTAAAAATGG - Intronic
1086980644 11:93194566-93194588 AAAAAAAGAATTTCCAAAAATGG - Intronic
1087206664 11:95403847-95403869 AAACTCTGAATTGCCAGAAAAGG - Intergenic
1088017000 11:105072831-105072853 ATATTCAGAATGTGCAAATATGG + Intronic
1088019550 11:105102733-105102755 ATATTCAGAATGTGCAAATATGG + Intergenic
1088146971 11:106692641-106692663 AAACACAGAATTTTAAAAAAGGG + Intronic
1089577055 11:119452313-119452335 AAAGTCACAATCTCCAACAATGG - Intergenic
1089958380 11:122593832-122593854 AATCAGAGAATGTCCACAAAAGG + Intergenic
1090086005 11:123651768-123651790 AAACTGAGAATGGGCAAAGATGG + Intronic
1090191040 11:124768534-124768556 AAATTCAGAAAGTCCAATAATGG + Intronic
1090332433 11:125942401-125942423 AACCAGAGAATGTCCAAAGACGG + Intergenic
1090434562 11:126676077-126676099 AAATTCAGTATGTCCCAAACTGG - Intronic
1090452792 11:126821398-126821420 AAAGCAAGAATATCCAAAAATGG - Intronic
1090556478 11:127882191-127882213 AAACTCAGCATGAAAAAAAATGG + Intergenic
1090913704 11:131144023-131144045 ATACTCAGCATATCTAAAAACGG - Intergenic
1091134128 11:133172694-133172716 AAAATCAGAATATTAAAAAAAGG - Intronic
1091553157 12:1552172-1552194 AAAGTCAGCAGGTCCAAAAATGG - Intronic
1091974858 12:4816117-4816139 AAGCTTAGCATGTCTAAAAATGG + Intronic
1094558665 12:31528715-31528737 AAAATCAGTATGTTCAAAACTGG - Intronic
1094561653 12:31560194-31560216 AAACTCAGAATGTCCAAAAATGG + Intronic
1094731365 12:33179896-33179918 TATCTGAGTATGTCCAAAAAAGG + Intergenic
1095079332 12:37979237-37979259 ATTCTCAGAATGCACAAAAACGG - Intergenic
1096281585 12:50259589-50259611 AAACTCACAATATAAAAAAATGG + Intronic
1096293410 12:50361927-50361949 AAACTAAGAATATCAAAAAAGGG - Intronic
1098094802 12:66943783-66943805 TAACTAAGAATGTACTAAAACGG + Intergenic
1098533731 12:71571488-71571510 AAAAACAGAAGGTGCAAAAAGGG - Intronic
1098611054 12:72458649-72458671 AAACTCAGTATGTCCAAAGCAGG + Intronic
1098674946 12:73277982-73278004 AATCTTAGAGTGTCCAAAAAAGG - Intergenic
1098910063 12:76199758-76199780 AACCTCATTATGTCCAAAACAGG + Intergenic
1099663736 12:85599072-85599094 AAACTCAAAATGTTGACAAAAGG - Intergenic
1100804623 12:98268691-98268713 AAACTCAAAATGTGAAAAGAAGG + Intergenic
1101458889 12:104868733-104868755 AAACTTAGTATATCCATAAATGG + Intronic
1106674168 13:31940111-31940133 AAACTCAGCATGTATAAAACTGG - Intergenic
1106820420 13:33458141-33458163 AAACTCAAAAAGTGCAAAGAAGG + Intergenic
1108724518 13:53165163-53165185 AAACTCAAAATGACTACAAAAGG - Intergenic
1110089515 13:71427662-71427684 AAAATAAGAATGTTTAAAAATGG + Intergenic
1110906805 13:80899834-80899856 ATAATCAAAATGTCCCAAAATGG - Intergenic
1111104215 13:83624685-83624707 AAAATCAGAATATACAGAAAAGG - Intergenic
1111714911 13:91867913-91867935 AAATTCAGAATTTTCAAAAGGGG + Intronic
1113052710 13:106231620-106231642 AAACTTAAAATGTCTAAAACAGG - Intergenic
1114477640 14:23008342-23008364 AAACCCAGAAAGCCCAAACAGGG + Intronic
1114886372 14:26856980-26857002 AAACTCAGACTCTCCACAGATGG - Intergenic
1114916754 14:27277261-27277283 AAGATCAGGATGTCCAGAAATGG + Intergenic
1115299946 14:31873958-31873980 AAATTTAAAATGTACAAAAAGGG + Intergenic
1115387189 14:32811285-32811307 AAATTAAGAATGACCAAAAATGG - Intronic
1116000751 14:39240110-39240132 AAACTCTGAAGGGCCACAAATGG - Intronic
1116280770 14:42903849-42903871 GAACTCAGAAAGTCCAATCATGG - Intergenic
1117058614 14:51938168-51938190 AAAGTTAGAAATTCCAAAAAAGG + Intronic
1117187117 14:53251296-53251318 AAACTTAGTATGTCCAAAGCTGG + Intergenic
1122948886 14:105029697-105029719 AAACACAGAATGCCCTGAAAGGG - Intergenic
1124247234 15:28081258-28081280 AAAGTCAGAATTTACATAAAAGG - Intronic
1124478979 15:30061315-30061337 ACAGACAGAATGTCCAAATAAGG + Intergenic
1124935216 15:34163644-34163666 AAACCCACAATGTTAAAAAACGG - Exonic
1125693904 15:41619583-41619605 AAAATCAAAAAGTTCAAAAACGG + Intergenic
1127556518 15:60093092-60093114 AAACACAGAAAATGCAAAAAAGG - Intergenic
1128337858 15:66799141-66799163 AAACCCAGAATGAGAAAAAATGG + Intergenic
1129330044 15:74822499-74822521 AAACACAGTGTGTCCAAATAAGG + Intronic
1129605618 15:77023642-77023664 AAATTCAGCGTGTCCAAAACCGG - Intronic
1129648834 15:77464844-77464866 AAACACTGAAAGTCCAACAAGGG - Intronic
1131031691 15:89191492-89191514 AAATACAGAATGGCCAAAAGAGG - Intronic
1132179292 15:99740065-99740087 AAACTAAAAATGTCCAAGAGTGG + Intergenic
1132287269 15:100672360-100672382 AAAAACAGAAAGTCCAAAAATGG - Intergenic
1133704837 16:8343789-8343811 AAACTCAGGATTTCCATGAAGGG - Intergenic
1135247757 16:20871726-20871748 TAACTCAAAATAACCAAAAAAGG + Intronic
1135959308 16:26982540-26982562 AAAATCAGAATCTCCAGAAGCGG + Intergenic
1136775037 16:32867372-32867394 AGACTCAGCTTGTCCAAAATGGG - Intergenic
1136895581 16:33994140-33994162 AGACTCAGCTTGTCCAAAATGGG + Intergenic
1140490944 16:75335339-75335361 AAATTCAAAATGATCAAAAAAGG + Intronic
1140545231 16:75801473-75801495 ATAATCAGATTGTCCAAAAGAGG + Intergenic
1140930910 16:79626973-79626995 AAACTTAGAAAGTACAAAAAAGG + Intergenic
1203077455 16_KI270728v1_random:1129481-1129503 AGACTCAGCTTGTCCAAAATGGG - Intergenic
1142837203 17:2595278-2595300 AAAAACAGAATTGCCAAAAATGG - Intronic
1143963008 17:10736132-10736154 AAACTAAGAATTTCCATAAAGGG - Intergenic
1144831572 17:18134451-18134473 AAACTCACAAAATCCATAAAAGG - Intronic
1146195012 17:30804133-30804155 AAAATCAGAATCTTTAAAAAAGG + Intronic
1146754105 17:35410946-35410968 AAACTCAGAATTTCCACAGTGGG - Intergenic
1146800647 17:35817371-35817393 AAACTAATCAGGTCCAAAAAGGG - Intronic
1147816639 17:43215362-43215384 AAATTCAGAACTTCCAAATATGG + Intronic
1148537850 17:48455658-48455680 TAAATCAGAATGTCCAGGAATGG - Intergenic
1149893706 17:60412566-60412588 AGAATCAGAATGTCCCAAGAGGG - Intronic
1151336471 17:73442879-73442901 AAACTCAAAATATAAAAAAAAGG - Intronic
1152870292 17:82750535-82750557 AAACTCGGAATGGCCATAGAAGG - Exonic
1153664164 18:7353013-7353035 AAACCCAGATTATCCACAAAGGG - Intergenic
1153745897 18:8179422-8179444 CAAGTCAGAAAGTCCAAGAATGG - Intronic
1155088779 18:22485479-22485501 CAAATCAGCATGCCCAAAAATGG - Intergenic
1155565819 18:27133011-27133033 AAAGCCAGAATGCCCAGAAAGGG + Intronic
1155994949 18:32321363-32321385 GAACTCAGAATGTCATTAAAAGG - Intronic
1156330732 18:36119253-36119275 AAACTCAGCATATTCCAAAAAGG + Intronic
1156333718 18:36149910-36149932 CAGCTCATAATGTCCAACAATGG - Intronic
1158383195 18:56958743-56958765 AAACAAAAACTGTCCAAAAATGG - Intronic
1159373301 18:67558319-67558341 AAAAACAGAATATCCAAGAATGG - Intergenic
1159465381 18:68776047-68776069 CTACTCATAATGCCCAAAAATGG - Intronic
1159587158 18:70291570-70291592 AAAGTCAAAAAGTCCAAAATTGG - Intronic
1160036681 18:75308300-75308322 AATCTCAGGATTTCCAGAAAAGG - Intergenic
1162802774 19:13120109-13120131 AAACTCAGTCTGTCCCAAAGGGG - Intronic
1163649837 19:18510819-18510841 AAACACAGAATGACCAAATGAGG + Intronic
1164217585 19:23163320-23163342 AAACAAAGAATGTGTAAAAAGGG + Intergenic
1164269624 19:23660086-23660108 AAATTCAGTCTGTCCAAAATGGG + Intronic
1164710670 19:30354932-30354954 AAACTCTGAAAGTCCAGAAAAGG - Intronic
1165399313 19:35587582-35587604 AAAATCAGAATGTCCCAATGGGG + Intergenic
1167187927 19:47960645-47960667 AGACTCAGAATAGCCAAAACAGG + Intergenic
1167773260 19:51536810-51536832 AAAATCACAATGTGGAAAAATGG + Intergenic
1168199258 19:54802761-54802783 AAACTCATAATTTTTAAAAAGGG - Intronic
925622399 2:5806924-5806946 AATCTCAGATAGTCCAGAAAAGG - Intergenic
926390788 2:12390462-12390484 AAACTCAGAATTTCCAAAACTGG - Intergenic
926781466 2:16476227-16476249 AGACTGAGAATGTCCAATAGGGG + Intergenic
926976435 2:18520974-18520996 AAACTCAGGATTTCCAAATGAGG - Intergenic
928193055 2:29191662-29191684 AAACTGAGAAGGTCAGAAAAAGG + Intergenic
929112614 2:38418105-38418127 AAACTAGGAATGTGAAAAAAAGG + Intergenic
930314768 2:49784716-49784738 AATGACACAATGTCCAAAAAGGG + Intergenic
930343780 2:50151678-50151700 GAACTGAGAATGACTAAAAATGG + Intronic
930495217 2:52132950-52132972 AATGTCAGAATGTCCAAACTAGG - Intergenic
930732853 2:54744746-54744768 AAACTCAGCATGTCTGAAATAGG - Intronic
931969489 2:67569831-67569853 AATCTCTTAATGTCCTAAAATGG + Intergenic
932801951 2:74748609-74748631 TAAATCAGAATGCCGAAAAAAGG - Intergenic
933287634 2:80401504-80401526 GAAGTCAGAATCTCCCAAAATGG - Intronic
934161749 2:89256276-89256298 AAATTCATAAAGTCCAAACAAGG + Intergenic
934475565 2:94591254-94591276 ACACTCAACATGTCCAGAAAGGG + Intronic
934487458 2:94729201-94729223 AAACTCAGAGTGTCTCACAATGG - Intergenic
934953525 2:98596379-98596401 AAATTAAGAATGCCAAAAAATGG + Intergenic
935332965 2:101990619-101990641 AAACTGTGAATGCCCCAAAATGG - Intergenic
936858532 2:116988592-116988614 AAGATCAGGATGTCCAAGAAAGG + Intergenic
937799566 2:126065964-126065986 AGAGACAGAATGTGCAAAAAAGG + Intergenic
938453108 2:131441520-131441542 AAACTTAATATGTCCAAAATGGG - Intergenic
939215956 2:139238721-139238743 AATTTCAGAATATTCAAAAAGGG + Intergenic
939311685 2:140487048-140487070 AAACTCAGAATAACAAAAGATGG + Intronic
939944603 2:148394582-148394604 AAAGACAGAATGTTCAAATAAGG - Intronic
940211204 2:151258144-151258166 TAACTCAGAATATGCAAAAGGGG + Intronic
940539654 2:154995808-154995830 AACCTGGGAATGACCAAAAAAGG - Intergenic
941505372 2:166337325-166337347 AAACACAGGATGTCCAAAATTGG - Intronic
941513274 2:166440234-166440256 AAAATCAGAATCTCTAAGAATGG + Intronic
942337247 2:174901860-174901882 AAAATCAGAATTTTTAAAAAGGG + Intronic
942479452 2:176368390-176368412 CAACTCAATATGTCCAAAACTGG - Intergenic
942847347 2:180442655-180442677 AGTCACAGAATGTCCTAAAAAGG + Intergenic
942869571 2:180718619-180718641 AAAATCAGATTGTACAATAAAGG + Intergenic
942904037 2:181159523-181159545 GAAATCAGAGTGGCCAAAAATGG + Intergenic
943927582 2:193805307-193805329 AAATTCGGAATGTCCAAGAGAGG - Intergenic
944197976 2:197075276-197075298 AAACTCAAAAATTCCAAATAGGG + Intronic
944807144 2:203293789-203293811 AAACTCTGAATTTTTAAAAAAGG - Intronic
945684679 2:212954693-212954715 AAACTCTTAATGTCCATCAAAGG + Intergenic
946497484 2:220209387-220209409 AAAAGCAGAATGTAAAAAAAAGG - Intergenic
947368709 2:229423308-229423330 AAACTCAGTATATCTTAAAATGG - Intronic
947541083 2:230979147-230979169 AAACTCAGAATGACCAAGAGTGG + Intergenic
949054172 2:241916057-241916079 AAACTAAGAATGACAATAAAAGG + Intergenic
1170426803 20:16243243-16243265 AAACTCAGCGTTTCCAAACATGG - Intergenic
1170997241 20:21374759-21374781 TACCCCAGAACGTCCAAAAAAGG - Intronic
1171281839 20:23907318-23907340 AAACTCAGAATGCGACAAAATGG - Intergenic
1171374688 20:24684522-24684544 GATCTCAGAGTCTCCAAAAAGGG + Intergenic
1172540771 20:35714362-35714384 TGACTCAGAATGTGCCAAAAAGG - Exonic
1173341136 20:42154066-42154088 GAACTCATAATGACCAAAACAGG - Intronic
1173892503 20:46523809-46523831 AGACTCACAATGGTCAAAAACGG + Intergenic
1174066509 20:47869534-47869556 AAAATCAGAAAGTCCTCAAAGGG - Intergenic
1174371875 20:50095838-50095860 AAACTCAAAATGTAAACAAAAGG + Intronic
1174907797 20:54571046-54571068 CAATTAAGAATTTCCAAAAATGG - Intronic
1174984222 20:55431849-55431871 ACACTGGGAATGTCTAAAAATGG + Intergenic
1176584270 21:8562897-8562919 GAACTCACAATGTCCAATTAAGG - Intergenic
1176895805 21:14377192-14377214 AAACACAGAATGAGCATAAAAGG - Intronic
1177193724 21:17880429-17880451 GAACTCTGAATGTCCTAAGAGGG + Intergenic
1177596491 21:23250071-23250093 AAACTCTGAATGAACAAAAATGG + Intergenic
1177893693 21:26836943-26836965 AGACTGAGATGGTCCAAAAAAGG + Exonic
1178221635 21:30667444-30667466 AACCTCAGAATGAGCGAAAAGGG + Intergenic
1178564623 21:33671886-33671908 AAACTACAAATGTACAAAAAAGG - Intronic
1179057774 21:37952082-37952104 AAACTCTGATTCTCCAGAAAAGG - Intronic
1179170616 21:38970170-38970192 ACACACAGAATGTCCTCAAAGGG - Intergenic
1180267081 22:10539801-10539823 GAACTCACAATGTCCAATTAAGG - Intergenic
1181314647 22:21963518-21963540 AAACTCAGACTGTCCACAGGTGG + Intronic
1181430025 22:22873759-22873781 AAGCACAGAATAACCAAAAAAGG + Intronic
1181591819 22:23889945-23889967 AGACTCAGAGGGTCCAAGAAAGG - Intronic
1182993105 22:34786883-34786905 AAACTTAAAATGTTCAAAACTGG - Intergenic
1183137535 22:35903603-35903625 AAACTCAACATGCCCAAAATTGG + Intronic
1183957452 22:41389841-41389863 AAAATCAGAATGTCCTTCAACGG - Intronic
949565469 3:5240788-5240810 AAACCCAGCATTTCCAAAGATGG + Intergenic
949627254 3:5880786-5880808 AAAATCAAAAGGTACAAAAAAGG - Intergenic
950220271 3:11190179-11190201 CAGCCCAGAATGTCCAAAGAGGG + Intronic
951419428 3:22466805-22466827 AGACTTAGGATGTCCAGAAAAGG + Intergenic
951713462 3:25611050-25611072 AAACTCAGCATGTCTGAAACTGG - Intronic
952779561 3:37082206-37082228 TGGCTCAGAATCTCCAAAAATGG + Intronic
954818915 3:53307614-53307636 AAACACAAAATCTCCAAGAAAGG - Intronic
955469902 3:59275452-59275474 AAATTCAGAATGGCAAAAAATGG + Intergenic
955908246 3:63830508-63830530 AAACTCAGTAAGACTAAAAAGGG + Intronic
956756558 3:72393659-72393681 AAACACAGAATGATCAAAACTGG + Intronic
957301504 3:78397567-78397589 AAACTCAGTATTTCCAAATCTGG - Intergenic
957931522 3:86884564-86884586 AAACTTAGCATGTCCAAATCTGG - Intergenic
958174252 3:89974961-89974983 GAACTCAGTATATCCAAAATAGG + Intergenic
959382401 3:105657128-105657150 AAAGCCAGACTGTCAAAAAAAGG + Exonic
960700271 3:120432522-120432544 AAAAACAGAATGAACAAAAAAGG - Intronic
961612858 3:128154143-128154165 AAACTCACAAGCTACAAAAAGGG + Intronic
963810647 3:149773227-149773249 TAACATAGAATGTCCAATAAGGG - Intronic
963945572 3:151142476-151142498 AAACACAAAATGTTCAGAAAGGG + Intronic
965062195 3:163798367-163798389 AAACTCAGAATATACAAAGCGGG - Intergenic
965218366 3:165894227-165894249 AAACTCAGTATGTCCAAAATCGG + Intergenic
965429950 3:168574164-168574186 AAACTCAGAATGGACATAGAAGG - Intergenic
965781136 3:172287288-172287310 AAACTCAGCATGTCCAAGAATGG - Intronic
966701579 3:182859150-182859172 AATCTCAGAATCTAGAAAAAAGG - Exonic
967462951 3:189767489-189767511 AAAATCTGAATGGCCAAGAATGG + Intronic
969247967 4:5947851-5947873 AAACTTAGAAAGTCTAAAAGTGG + Intronic
970067296 4:12113135-12113157 AAACACACAATATCCAAAGATGG - Intergenic
970953114 4:21779600-21779622 AAAATAAGAATATACAAAAATGG + Intronic
971540188 4:27806303-27806325 AAACTCAAATTGACAAAAAAGGG - Intergenic
972268591 4:37486703-37486725 AAACACTGAAAGTCCCAAAAAGG - Intronic
972384591 4:38552771-38552793 AAACTCAGAAGGTGCAAAGTTGG + Intergenic
972636556 4:40889410-40889432 AAAAGCAGAATGTTCAGAAATGG + Intronic
973047003 4:45546735-45546757 AAACACAGTATGGCCAGAAAGGG + Intergenic
973576769 4:52297576-52297598 AAACTCAGAAAGTCTCAAAGAGG + Intergenic
973981598 4:56312847-56312869 AAACTCTGATTCTCCAAAACAGG + Intronic
975218296 4:71782716-71782738 AAACACAGAAGGTCCAATAATGG - Intronic
976065694 4:81184728-81184750 AAACTAAGAATGTTGAAAAAGGG + Intronic
976291585 4:83423944-83423966 AAATCAAGAATGTTCAAAAAAGG + Intronic
976295077 4:83462820-83462842 AAATTCAGAATTTGGAAAAAAGG + Exonic
976349076 4:84040130-84040152 AAACTGAGAATGTCCTATACTGG - Intergenic
976659883 4:87529546-87529568 AAAATAAAAATCTCCAAAAAAGG - Intronic
976820289 4:89198679-89198701 AAAATCAGAAAATACAAAAAAGG - Intergenic
977408712 4:96633940-96633962 AAACTCAGCATGTTCACTAATGG - Intergenic
978157254 4:105504199-105504221 AAACTCATCAGCTCCAAAAAAGG - Intergenic
978595807 4:110375733-110375755 AAACTTAGTATGTCCAAAGCTGG - Intronic
979117803 4:116849836-116849858 AAATTCAGAATCTGCAATAATGG - Intergenic
979205147 4:118030458-118030480 ATACTGAGAATCTCAAAAAATGG - Intergenic
979307266 4:119161672-119161694 AAACCTTGAATGTTCAAAAATGG + Intronic
979969844 4:127120994-127121016 AAACTCACAATAACCAAATATGG - Intergenic
980417286 4:132508098-132508120 AAAACCAGAATGGACAAAAATGG + Intergenic
980476637 4:133326653-133326675 AAACTCAATATTACCAAAAATGG - Intergenic
980498603 4:133618292-133618314 AAAGTCAGAATGTAGAGAAAAGG - Intergenic
980806538 4:137822545-137822567 ACACTCAGAATGTCAAAATTAGG + Intergenic
981369510 4:143943618-143943640 ATCCTTAGATTGTCCAAAAAGGG - Intergenic
981379254 4:144053565-144053587 ATCCTTAGATTGTCCAAAAAGGG - Intergenic
981404332 4:144350162-144350184 GAATTCAGAATGTTCATAAATGG + Intergenic
981542535 4:145860692-145860714 AAACTCAGGATGGCTTAAAATGG + Intronic
984105215 4:175537072-175537094 AAACTCAAAATTGTCAAAAATGG - Intergenic
987439123 5:17933693-17933715 AAACTCAGAAATTCTAAAACTGG + Intergenic
987483749 5:18495574-18495596 AAACTCAAAATAACCAAAATAGG + Intergenic
987512635 5:18859665-18859687 AAACTCAGAATATACAAATTGGG - Intergenic
987881806 5:23756770-23756792 AGGCACAGAATGTCCAAGAATGG + Intergenic
988783845 5:34547902-34547924 TATCTGAGTATGTCCAAAAAAGG + Intergenic
990729228 5:58790134-58790156 AAACTCAGCATGTCCAAAATAGG + Intronic
990736257 5:58866387-58866409 AGAATGAGAATGTCCAAAAGTGG - Intergenic
992738686 5:79750978-79751000 AGGCTCAGAATGAACAAAAATGG - Intronic
992810583 5:80383898-80383920 AAACTCAACATCTCCAAATATGG + Intergenic
995086356 5:108115217-108115239 AAAATCAGAATGTTCAAACTAGG + Intronic
996148296 5:120002502-120002524 AAACTCAAAATGTTAAAAATGGG + Intergenic
997409255 5:133678598-133678620 AAAATGAGCATGTCCAAAACTGG - Intergenic
998370629 5:141658671-141658693 AAAGTCAGAAGGGCAAAAAAAGG + Intronic
998667095 5:144309771-144309793 CAACTAATAATGTCCCAAAATGG - Intronic
998939317 5:147263342-147263364 ATACTCAGAATGTCCAAACAGGG + Intronic
999678717 5:154034434-154034456 AAAATCAGAATGTACAGACAAGG + Intronic
1002056626 5:176601572-176601594 AAACTCAGCTTGTCCAAAAACGG - Intronic
1002139172 5:177128315-177128337 AAACTCAGATCCTCCCAAAAAGG - Intergenic
1004540257 6:16543088-16543110 AATCACAGCATGTCCACAAATGG + Intronic
1004569334 6:16830410-16830432 AAATACACAATATCCAAAAAGGG + Intergenic
1004645617 6:17558163-17558185 AAACTGAGAACATCCTAAAATGG + Intergenic
1004800329 6:19139746-19139768 GAAGTCACAATGTCCATAAAGGG + Intergenic
1004945234 6:20604892-20604914 AAGCTCAGTATTTCCAAGAAAGG - Intronic
1005116082 6:22339146-22339168 AAAATAATACTGTCCAAAAAGGG - Intergenic
1008313891 6:50014992-50015014 AAACTCTACATGTCCAAAATTGG + Intronic
1008354916 6:50541355-50541377 TCACTCAGATTCTCCAAAAATGG - Intergenic
1008799728 6:55351793-55351815 AAAATCAGCATGTCAAAATATGG + Intronic
1010038397 6:71352876-71352898 AAAGTCAAACTGTACAAAAAAGG + Intergenic
1010702084 6:79062924-79062946 GAACACAAAGTGTCCAAAAAGGG - Intronic
1010771904 6:79841394-79841416 ACACTCAGCATGTCTAAAGATGG - Intergenic
1011293087 6:85797619-85797641 AAACTCAAGATGTCTGAAAATGG - Intergenic
1011859587 6:91738073-91738095 AAATTCAGAGTAACCAAAAATGG - Intergenic
1012109259 6:95205536-95205558 AAACTTAAAATGTCCAAAAAAGG - Intergenic
1012136866 6:95568375-95568397 AAACCCAAAAAGTCAAAAAAAGG - Intergenic
1012216212 6:96587973-96587995 AAAGTCTGAATGTCCATCAAGGG - Intronic
1013184025 6:107741671-107741693 AAATGCAGAAGGTCCCAAAAAGG - Intronic
1013480227 6:110546646-110546668 AAACTCAGTATGTTCAAAAGTGG + Intergenic
1014443052 6:121495524-121495546 AAGCACAGAATGTCCAACCAGGG - Intergenic
1014702372 6:124706576-124706598 AAACTGAGAAGTTCCAAACAGGG + Intronic
1014984810 6:127991475-127991497 AAACTAAGTAATTCCAAAAAAGG + Intronic
1015066255 6:129032640-129032662 AAACTCATTATGTAAAAAAAGGG + Intronic
1015340213 6:132090454-132090476 AAACTCAGAAAGGCAAAACAAGG + Intergenic
1015778920 6:136843304-136843326 ACACTCAGAGTGTTCAATAAAGG + Intronic
1015806546 6:137115490-137115512 AAACTGAGAATCTTCATAAAAGG - Intergenic
1016678740 6:146803677-146803699 AAACTCACAATGTTAAAAAACGG - Intronic
1016851160 6:148620399-148620421 TAACTCAAATTGTCCAACAACGG + Intergenic
1017258302 6:152359732-152359754 AAACTGATTATGTCCAGAAATGG + Intronic
1017549461 6:155489723-155489745 AAAATCAGAATGTCCCAGCATGG - Intergenic
1017849509 6:158292684-158292706 ATAATCAGTATGTCCAAACAGGG - Intronic
1018139333 6:160812437-160812459 AAACACAGAATCTGCAAATAAGG + Intergenic
1021517984 7:21507762-21507784 AGACACAGACTGACCAAAAATGG - Intronic
1021691096 7:23231496-23231518 ATATTGAGAATGACCAAAAAAGG - Intergenic
1021779393 7:24087583-24087605 AAATACACAATGACCAAAAAAGG - Intergenic
1021800020 7:24295776-24295798 AAGTTCAGTATGTCCAAAATTGG + Intergenic
1022761114 7:33352272-33352294 AAAAGCATAATGGCCAAAAATGG - Intronic
1022769925 7:33458878-33458900 AAACTCAGAAACACCAAATAAGG - Intronic
1023003393 7:35836591-35836613 AAACTCTGAATCCCAAAAAATGG - Intronic
1023223051 7:37940344-37940366 AAACTCAAAATGACAGAAAATGG - Intronic
1024820693 7:53326502-53326524 AAACCCTGAAAGTCCAACAACGG - Intergenic
1024823367 7:53360592-53360614 AAACTCAAAATGGCTAAAATTGG - Intergenic
1025010928 7:55397746-55397768 AATCTGAGAATCTCCAAAGAAGG - Intronic
1025500746 7:61291967-61291989 ACTTTCAGAATGTACAAAAAGGG - Intergenic
1025515608 7:61638190-61638212 ACTTTCAGAATGTACAAAAAGGG - Intergenic
1025539943 7:62067016-62067038 ACTTTCAGAATGTACAAAAAGGG - Intergenic
1026790909 7:73331048-73331070 AATCTCAGAATGATGAAAAAGGG - Intronic
1027930938 7:84534188-84534210 AACCTCTGAATTTTCAAAAATGG - Intergenic
1028146353 7:87323858-87323880 CAGCTCAGAAAGTGCAAAAAGGG - Intergenic
1028489711 7:91397505-91397527 AAAATGAGAATGACCAGAAAAGG - Intergenic
1028852770 7:95554794-95554816 AAAGTGGGAATGTCCAGAAAAGG - Intergenic
1030333162 7:108294810-108294832 AAACTAAGCATGTCCAAAAAAGG - Intronic
1030432950 7:109475453-109475475 AATCTCAAAATGGCTAAAAATGG + Intergenic
1031588017 7:123556238-123556260 AAACTTAACATGTCCAAAATGGG - Intronic
1032009972 7:128339298-128339320 AAACTCAGAGTGCCCAAAGAAGG - Exonic
1032913652 7:136462527-136462549 GAACTCATCATGTCCCAAAAGGG + Intergenic
1034788029 7:153943052-153943074 AAAATCAGAACGGTCAAAAAGGG - Intronic
1035037490 7:155904698-155904720 AAACACAATAAGTCCAAAAAAGG - Intergenic
1038316520 8:26489141-26489163 CCGCTCAGAATGTGCAAAAAGGG - Intronic
1040804245 8:51377154-51377176 AATCTGAGAGTGTCCAGAAATGG - Intronic
1041154748 8:54973661-54973683 AATATCAGAGTGTCCACAAAGGG + Intergenic
1041215262 8:55594246-55594268 AAACTCATAAAGTCAAAAAATGG + Intergenic
1041226663 8:55707024-55707046 AAACAAAGAATGTGTAAAAAGGG - Intronic
1041638932 8:60175870-60175892 AATCTCGGAATTTCTAAAAAAGG + Intergenic
1041783543 8:61605763-61605785 AAACTCAGACTGACCAAGAATGG + Intronic
1042874670 8:73430090-73430112 ATACTCAGAATGTGAAGAAATGG - Intronic
1043521000 8:81045081-81045103 ACACACAGAATGTCCAAAGTGGG + Intronic
1043617898 8:82150016-82150038 AAACATAGATTGTCCAATAAAGG + Intergenic
1044141601 8:88660562-88660584 AAAAGCAGAATCTCTAAAAATGG + Intergenic
1044278194 8:90326415-90326437 AAACTCAACATGTCTAAAAATGG + Intergenic
1045576854 8:103431828-103431850 AAACTGAGAATGTGCAAAGCAGG - Intronic
1045941310 8:107741561-107741583 AAACTCAAAATGGACAATAATGG + Intergenic
1046155007 8:110276869-110276891 AAAATCAGAATGTTAAAAATAGG + Intergenic
1046190905 8:110792776-110792798 CATCTCATAATGTCCAATAATGG + Intergenic
1046466411 8:114609666-114609688 AAACTCATAAAATACAAAAATGG - Intergenic
1046723945 8:117654468-117654490 AAACTCAGATTTGCAAAAAAAGG + Intergenic
1047036870 8:120949456-120949478 AACCTCACAATGTCAAAAAAGGG - Intergenic
1047889493 8:129292055-129292077 AAACTCAGAATATTCAGATATGG - Intergenic
1048009109 8:130442844-130442866 AAACGCAGCAGGTCCCAAAATGG + Intronic
1048605212 8:135961273-135961295 AAACTCAGAATTTACAAATAAGG - Intergenic
1051396860 9:16632073-16632095 AAACTTAGAATCTCCTTAAAAGG - Intronic
1051757658 9:20421731-20421753 AAACTCAGATTTTCCATAAAAGG + Intronic
1052195068 9:25702140-25702162 TGGCTCAGAATGTCCAACAATGG + Intergenic
1052256065 9:26458101-26458123 TAAATCAGAATCTCCAAAGATGG - Intergenic
1052507820 9:29378065-29378087 AAACACAGAATGGGTAAAAAAGG - Intergenic
1053223087 9:36327583-36327605 AAACTCAACATATCCAAATATGG - Intergenic
1053670348 9:40355229-40355251 AAACTCAGAGTGTCTCACAATGG + Intergenic
1053682501 9:40494824-40494846 ACACTCAACATGTCCAGAAAGGG - Intergenic
1053920137 9:42981492-42981514 AAACTCAGAGTGTCTCACAATGG + Intergenic
1053932484 9:43123150-43123172 ACACTCAACATGTCCAGAAAGGG - Intergenic
1054281213 9:63130105-63130127 ACACTCAACATGTCCAGAAAGGG + Intergenic
1054295600 9:63330324-63330346 ACACTCAACATGTCCAGAAAGGG - Intergenic
1054381467 9:64495214-64495236 AAACTCAGAGTGTCTCACAATGG + Intergenic
1054393621 9:64634828-64634850 ACACTCAACATGTCCAGAAAGGG - Intergenic
1054428269 9:65140041-65140063 ACACTCAACATGTCCAGAAAGGG - Intergenic
1054502110 9:65881502-65881524 ACACTCAACATGTCCAGAAAGGG + Intronic
1054514265 9:66021071-66021093 AAACTCAGAGTGTCTCACAATGG - Intergenic
1055620765 9:78122671-78122693 AAACTTAACATGTCCAAAAATGG + Intergenic
1055831583 9:80385628-80385650 AAACACAGGATGGCCAAATACGG - Intergenic
1056068850 9:82964882-82964904 AATCTCAGAAGGTTCCAAAAGGG + Intergenic
1059976621 9:119724694-119724716 AAACTCAGCATGTCCCAAAGTGG + Intergenic
1061691635 9:132337286-132337308 CATAACAGAATGTCCAAAAAAGG + Intronic
1185681882 X:1895322-1895344 AAAATCAGAATATACCAAAATGG + Intergenic
1185762386 X:2698640-2698662 AAACTCTGTATCTACAAAAAAGG - Intronic
1185989648 X:4878959-4878981 TAACTCAGAATCTCTAAGAATGG + Intergenic
1186443965 X:9609923-9609945 AAACTCAGAAAGTGCAATATTGG - Intronic
1186583124 X:10842285-10842307 AAAGGCAAAATCTCCAAAAAGGG + Intergenic
1186765955 X:12770892-12770914 AATCTCAGAAGGGCCAAATATGG + Intergenic
1188145780 X:26611472-26611494 AAAATAAGAATGTAAAAAAATGG - Intergenic
1188403983 X:29783580-29783602 AAAATCATAATGTCTAGAAAGGG + Intronic
1188540112 X:31240270-31240292 ATACTCTCAATGTGCAAAAATGG + Intronic
1190847753 X:54209914-54209936 GAATTGAGAATGTCCAAGAAAGG - Intronic
1190959331 X:55229572-55229594 AAACTCAGATGGTGGAAAAAGGG - Intronic
1191934144 X:66408193-66408215 AAACTATGAATCTCCACAAAGGG - Intergenic
1192381237 X:70618799-70618821 CAACCCATAATGTCCAACAACGG + Intronic
1193394389 X:80967398-80967420 AAACTAAGAACGTTGAAAAAAGG - Intergenic
1193502264 X:82293461-82293483 AAACTCAAAAGATACAAAAAAGG + Intergenic
1193511979 X:82413510-82413532 GAACACAGCATGTCCAAAAATGG - Intergenic
1194358894 X:92922509-92922531 AAACAAAGAAGGTCCAAATAAGG - Intergenic
1194778580 X:97995247-97995269 AAAGTCAGTAGGTTCAAAAATGG + Intergenic
1194915775 X:99706730-99706752 AAACTCAGAACGTCTATAAAAGG + Intergenic
1195810488 X:108824123-108824145 AAGCTAAGAATGTTGAAAAACGG - Intergenic
1196821593 X:119705587-119705609 AAACTCAACATGTCCCAAACTGG - Intergenic
1197163905 X:123354701-123354723 AAACTTAAAATGTCAAAACAAGG - Intronic
1198000143 X:132425616-132425638 AAGCTCATAATCTTCAAAAAGGG - Intronic
1198453688 X:136793996-136794018 AAACTCAGTATGACCCAAATTGG + Intergenic
1198633412 X:138668506-138668528 AAACTCAAAATAACCAACAATGG - Intronic
1200021069 X:153209291-153209313 AACCTCATAATGTCCAATATTGG - Intergenic
1200104902 X:153706688-153706710 AGACTCAGCTTGTCCAAAACGGG + Intronic
1200109870 X:153735166-153735188 AAACCCAAAATGTCCATCAAGGG - Intronic
1200667110 Y:6038522-6038544 AAACAAAGAAGGTCCAAATAAGG - Intergenic