ID: 1094564874

View in Genome Browser
Species Human (GRCh38)
Location 12:31590632-31590654
Sequence CTGTGGGGACGCGCGGGAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 378
Summary {0: 1, 1: 0, 2: 4, 3: 32, 4: 341}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094564874_1094564892 22 Left 1094564874 12:31590632-31590654 CCGCCTCCCGCGCGTCCCCACAG 0: 1
1: 0
2: 4
3: 32
4: 341
Right 1094564892 12:31590677-31590699 GCTCAGCGCCGCCGCAGCCCTGG 0: 1
1: 0
2: 4
3: 33
4: 319
1094564874_1094564884 0 Left 1094564874 12:31590632-31590654 CCGCCTCCCGCGCGTCCCCACAG 0: 1
1: 0
2: 4
3: 32
4: 341
Right 1094564884 12:31590655-31590677 CGTCCCCCGCGCCCCTGAGGGGG 0: 1
1: 0
2: 0
3: 13
4: 97
1094564874_1094564881 -3 Left 1094564874 12:31590632-31590654 CCGCCTCCCGCGCGTCCCCACAG 0: 1
1: 0
2: 4
3: 32
4: 341
Right 1094564881 12:31590652-31590674 CAGCGTCCCCCGCGCCCCTGAGG 0: 1
1: 0
2: 2
3: 16
4: 182
1094564874_1094564883 -1 Left 1094564874 12:31590632-31590654 CCGCCTCCCGCGCGTCCCCACAG 0: 1
1: 0
2: 4
3: 32
4: 341
Right 1094564883 12:31590654-31590676 GCGTCCCCCGCGCCCCTGAGGGG 0: 1
1: 0
2: 0
3: 6
4: 115
1094564874_1094564882 -2 Left 1094564874 12:31590632-31590654 CCGCCTCCCGCGCGTCCCCACAG 0: 1
1: 0
2: 4
3: 32
4: 341
Right 1094564882 12:31590653-31590675 AGCGTCCCCCGCGCCCCTGAGGG 0: 1
1: 0
2: 0
3: 4
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094564874 Original CRISPR CTGTGGGGACGCGCGGGAGG CGG (reversed) Intronic
900407352 1:2498500-2498522 CTGAGGGGATGCCGGGGAGGTGG - Intronic
901922928 1:12549027-12549049 CAGTGGGGAGGCGGGGGAGAAGG - Intergenic
903643286 1:24875008-24875030 CTGTGGGTACGGGATGGAGGAGG - Intergenic
904750987 1:32741582-32741604 TCGTGGGGCCGCCCGGGAGGGGG - Intergenic
905629105 1:39509017-39509039 CTGTGGGGACGCCCGTGCTGTGG - Intronic
906131401 1:43460567-43460589 TTGTGGGGAAGAGTGGGAGGGGG + Intergenic
907038277 1:51236085-51236107 ATGTGGGGAGGCGCGGGAGACGG + Intergenic
907458514 1:54591617-54591639 CTGTGGGGAGGAGGGGCAGGAGG - Intronic
907935884 1:59041926-59041948 TTGTGGGGAAGAGGGGGAGGTGG + Intergenic
908544403 1:65148916-65148938 CTCTAGGGACTCGGGGGAGGGGG - Intronic
908544416 1:65148948-65148970 CTCTGGGCTCCCGCGGGAGGGGG - Intronic
911879021 1:103209272-103209294 TTGTGGGGGGGTGCGGGAGGAGG - Intergenic
912625798 1:111204056-111204078 CTGAGGGGGCGAGGGGGAGGCGG - Intronic
915530136 1:156498599-156498621 CTGGGGGGAAGGGGGGGAGGGGG - Intronic
915683974 1:157612098-157612120 CTTTGGGGACTCGGGGGAGATGG + Intergenic
915977434 1:160400469-160400491 CTGTGGGAACAGCCGGGAGGCGG + Intergenic
916574616 1:166056407-166056429 TGGTGGGGACGGGCAGGAGGAGG + Intergenic
916666992 1:166975583-166975605 CGGGGCGGAGGCGCGGGAGGCGG - Intronic
919552883 1:199013999-199014021 CTGTGGGGAAGCTGGTGAGGTGG + Intergenic
920174672 1:204093113-204093135 ACGTGGGGACGTGGGGGAGGTGG + Intronic
920411309 1:205763256-205763278 GGGTGGGGAGGCGGGGGAGGGGG - Intergenic
922215415 1:223516182-223516204 GTGTGGGGAATCCCGGGAGGGGG - Intergenic
922707027 1:227795351-227795373 CTGTGGGAACGAGGGGGTGGTGG - Intergenic
922721413 1:227901975-227901997 CGGTGGAGAAGCTCGGGAGGAGG + Intergenic
923126826 1:231040417-231040439 CTGGAGGGGCGCGAGGGAGGAGG - Intergenic
1063375806 10:5553636-5553658 CTGTGGGGCTGGGAGGGAGGAGG - Intergenic
1064792635 10:18975237-18975259 TTGTGGGGTCGCGGGGGAGGAGG + Intergenic
1066378979 10:34885366-34885388 CTGAGGGGAAGCTCGCGAGGAGG + Intergenic
1067175532 10:43943326-43943348 TTGTGGGGAAGCGTGGGTGGGGG + Intergenic
1068912298 10:62391402-62391424 CTTTGAGGACTCGGGGGAGGGGG - Intronic
1069648701 10:70025869-70025891 TTGTGGGGATGGGTGGGAGGAGG + Intergenic
1069988119 10:72297937-72297959 CTGGGGGGCGCCGCGGGAGGAGG - Intergenic
1070314193 10:75295110-75295132 GGGAGGGGACGCGCGGGAGGCGG + Intergenic
1071038491 10:81277356-81277378 CTCTGGGGCGGCGGGGGAGGGGG + Intergenic
1071354785 10:84783719-84783741 CTGTGGGGAGGGGTGTGAGGGGG + Intergenic
1073048729 10:100654804-100654826 CAGTCGGGACCCGCGGGAGGGGG - Intergenic
1073051162 10:100668230-100668252 GTGGGGGGAGGGGCGGGAGGAGG - Intergenic
1075079803 10:119375739-119375761 CTGTGGGCATGCCGGGGAGGTGG + Intronic
1076792921 10:132786252-132786274 CGGCGGGGGCGCGCGGGCGGGGG - Intergenic
1076874739 10:133210588-133210610 CTGTGGGGCGGGGCGGGCGGCGG - Intronic
1077334253 11:1996466-1996488 GTGTGGGGAGGGGCGGGTGGGGG + Intergenic
1078558345 11:12349634-12349656 CTGTGGGTACGTGTGTGAGGGGG - Intronic
1079129340 11:17738321-17738343 CTGTGGGGAGGGGCTGGAGGAGG + Intronic
1079203578 11:18395105-18395127 CTCTTGGGACGCTCGAGAGGTGG + Intronic
1080012355 11:27472084-27472106 CGGCGGGGACGCGAGGGGGGGGG - Intronic
1083669451 11:64291941-64291963 CTGTGCGGACGCGGGGGAGGCGG + Intronic
1083729170 11:64643616-64643638 GGGAGGGGAAGCGCGGGAGGAGG + Intronic
1084539360 11:69776442-69776464 CTGTGGGGATGCGGTGGAGGTGG - Intergenic
1086887746 11:92224608-92224630 GAGAGGGGGCGCGCGGGAGGGGG - Intergenic
1088658633 11:112025590-112025612 CTGTTGCGACGAGCGGGAGCCGG - Exonic
1088857939 11:113773294-113773316 CTGTGGGGACGAACAGGCGGTGG - Intronic
1089648467 11:119895646-119895668 CTGTGGGCCTGCGCAGGAGGAGG - Intergenic
1090252876 11:125263614-125263636 CTGAGGAGCAGCGCGGGAGGGGG + Intronic
1202817236 11_KI270721v1_random:51648-51670 GTGTGGGGAGGGGCGGGTGGGGG + Intergenic
1091550053 12:1530283-1530305 CGGGGAGGAGGCGCGGGAGGCGG + Intronic
1091624733 12:2113295-2113317 CTGTGGGGACGGGGTGGAGGTGG + Intronic
1091689021 12:2583242-2583264 CGATAGGGACGCGCGGGAGCGGG + Intronic
1091820642 12:3473002-3473024 CAGTGGGGAAGAGCTGGAGGTGG - Intronic
1092078653 12:5694467-5694489 TTGTGGGGACACTCGGGAGCTGG - Intronic
1093922633 12:24876796-24876818 CTGTCGGAAGGGGCGGGAGGAGG + Intronic
1094564874 12:31590632-31590654 CTGTGGGGACGCGCGGGAGGCGG - Intronic
1095893474 12:47257037-47257059 TTGTGGGGAAGAGTGGGAGGGGG + Intergenic
1095938055 12:47706037-47706059 TTGTGGGGAAGCGCAGGAGGCGG - Exonic
1096778267 12:53976940-53976962 CTGTGGAGAGGAGAGGGAGGGGG - Exonic
1097013530 12:55969606-55969628 ATGTGGGGAGGAGAGGGAGGGGG - Intronic
1097293667 12:57941514-57941536 CTGACGGGGAGCGCGGGAGGCGG - Intergenic
1098116239 12:67179814-67179836 CTGTGGTGAAGTGGGGGAGGGGG + Intergenic
1098638670 12:72814706-72814728 GTGTGGGGAGGTGCAGGAGGTGG + Intergenic
1099439998 12:82687395-82687417 CTGCGGAGACGGGCGCGAGGAGG + Exonic
1099472505 12:83068855-83068877 TTGTGGGGAAGAGTGGGAGGGGG - Intronic
1099978038 12:89566804-89566826 TTGTGGGGATGTGTGGGAGGTGG + Intergenic
1102962015 12:117099204-117099226 CTGTGAGTACCCGCGGGGGGCGG - Exonic
1104110676 12:125701092-125701114 CTGTGGGGTTGTGGGGGAGGTGG + Intergenic
1104889777 12:132134680-132134702 CCGTGGGCACACTCGGGAGGTGG - Intergenic
1104889788 12:132134715-132134737 CCGTGGGCACACTCGGGAGGTGG - Intergenic
1104889812 12:132134785-132134807 CCGTGGGCACACTCGGGAGGTGG - Intergenic
1104889835 12:132134856-132134878 CCGTGGGCACACTCGGGAGGTGG - Intergenic
1104889870 12:132134962-132134984 CCGTGGGCACACTCGGGAGGTGG - Intergenic
1104889903 12:132135069-132135091 CCGTGGGCACACTCGGGAGGTGG - Intergenic
1104889914 12:132135104-132135126 CCGTGGGCACACTCGGGAGGTGG - Intergenic
1104889925 12:132135139-132135161 CCGTGGGCACACTCGGGAGGTGG - Intergenic
1104889948 12:132135208-132135230 CCGTGGGCACACTCGGGAGGTGG - Intergenic
1104889971 12:132135279-132135301 CCGTGGGCACACTCGGGAGGTGG - Intergenic
1104889994 12:132135348-132135370 CCGTGGGCACACTCGGGAGGTGG - Intergenic
1104890017 12:132135421-132135443 CCGTGGGCACACTCGGGAGGTGG - Intergenic
1104890028 12:132135457-132135479 CCGTGGGCACACTCGGGAGGTGG - Intergenic
1104890063 12:132135562-132135584 CCGTGGGCACACTCGGGAGGTGG - Intergenic
1104890074 12:132135597-132135619 CCGTGGGCACACTCGGGAGGTGG - Intergenic
1104890157 12:132135842-132135864 CCGTGGGCACACTCGGGAGGTGG - Intergenic
1104890192 12:132135945-132135967 CCGTGGGCACACTCGGGAGGTGG - Intergenic
1104890287 12:132136228-132136250 CCGTGGGCACACTCGGGAGGTGG - Intergenic
1104890310 12:132136300-132136322 CCGTGGGCACACTCGGGAGGTGG - Intergenic
1104890321 12:132136335-132136357 CCGTGGGCACACTCGGGAGGTGG - Intergenic
1105040273 12:132956019-132956041 CTCTGGGGGCGCGCGGGGGTGGG - Intronic
1105319843 13:19308466-19308488 TTGTGGGGAAGAGTGGGAGGAGG - Intergenic
1106234470 13:27850470-27850492 CTTTGGGGACTCGGGGGAGGAGG + Intergenic
1106811791 13:33365212-33365234 CTGTGGGGAAGGGTGGGAAGAGG + Intergenic
1107359462 13:39603140-39603162 CTGTGGGCGCGCGCGGGCGCCGG + Exonic
1107445080 13:40463345-40463367 TTGTGGGGAAGGGTGGGAGGGGG - Intergenic
1107624880 13:42272127-42272149 CTGGGGGTCAGCGCGGGAGGGGG + Intergenic
1110119546 13:71865614-71865636 CGGAGGGGACGAGAGGGAGGAGG - Intronic
1113804223 13:113104062-113104084 CTGTGCGGGCAGGCGGGAGGGGG - Intergenic
1114519042 14:23321562-23321584 CGGTGGGGAGGCCGGGGAGGGGG + Exonic
1116467692 14:45252985-45253007 CTGCGGGGACCCGCGGTAGGAGG + Intronic
1116844448 14:49852474-49852496 CTGGGAGGACGCGGGGGATGGGG + Intronic
1116973557 14:51093670-51093692 CGGTGGGGTCGCGCGGACGGCGG - Intronic
1118030361 14:61812658-61812680 CGGCGGGGGCGCGCGGCAGGAGG + Intergenic
1118750673 14:68805983-68806005 CTTTGGGGAAGCTGGGGAGGAGG - Intergenic
1119645380 14:76344418-76344440 TTGTGGGGAAGAGTGGGAGGGGG - Intronic
1120730185 14:87992935-87992957 CTGCGGGGATACGCGGGGGGCGG - Intronic
1121463667 14:94100800-94100822 CTGGGGGGAGGCGGGGGATGGGG - Intronic
1122195520 14:100082172-100082194 CTGGAGGGATGCGGGGGAGGGGG - Intronic
1122418330 14:101560826-101560848 GTGTGAGCGCGCGCGGGAGGCGG + Intergenic
1122418759 14:101562720-101562742 CTGAGGGCACGCTGGGGAGGGGG - Exonic
1122582008 14:102777193-102777215 CGGCGGGGACGGGAGGGAGGCGG + Intergenic
1122715754 14:103696096-103696118 CTGTGGGGGGGGGCGGGGGGCGG - Intergenic
1123037941 14:105478901-105478923 TTGTGGGCACGCGCGGGCTGGGG + Intronic
1123066811 14:105623157-105623179 CTGTGCGGAGGCGCAGGACGGGG - Intergenic
1123068247 14:105628789-105628811 CTGAGTGCACGGGCGGGAGGAGG - Intergenic
1123070839 14:105641868-105641890 CTGTGCGGAGGCGCAGGACGGGG - Intergenic
1123075797 14:105666925-105666947 CTGTGCGGAGGCGCAGGACGGGG - Intergenic
1123090495 14:105740152-105740174 CTGTGCGGAGGCGCAGGACGGGG - Intergenic
1123096131 14:105767902-105767924 CTGTGCGGAGGCGCAGGACGGGG - Intergenic
1123097840 14:105774814-105774836 CTGAGTGCACGGGCGGGAGGAGG - Intergenic
1124612162 15:31216049-31216071 CGGGCGGGGCGCGCGGGAGGCGG + Intergenic
1125603657 15:40928467-40928489 GTGAGGGGACGCGCTGGAGGCGG + Intergenic
1125816062 15:42585541-42585563 CTTTGGGGACTCCCGGGAGAAGG + Exonic
1126612584 15:50544534-50544556 CTGTGGGGAAGTGGGGGTGGGGG + Intronic
1127753485 15:62068150-62068172 CGTCGGGGACGCGCAGGAGGCGG - Exonic
1127763572 15:62164441-62164463 CGTCGGGGACGCGCAGGAGGCGG + Exonic
1128462921 15:67884795-67884817 CTGTGGGGAGGCGGGGGCGGCGG - Intergenic
1128582695 15:68820208-68820230 GAGGGGGGAGGCGCGGGAGGGGG + Intronic
1130908714 15:88256883-88256905 GTGTGGGGAGGGGAGGGAGGGGG - Intergenic
1132055497 15:98648309-98648331 CTCTGTGTGCGCGCGGGAGGCGG + Intergenic
1132147044 15:99435254-99435276 CCCTGGGGACGCGCAGGGGGAGG + Intergenic
1132670593 16:1100789-1100811 AGGTGGGGAGGCGCGGGGGGAGG + Intergenic
1132843527 16:1989927-1989949 CGGCGGGGACGCGCGGGACGGGG - Exonic
1132945498 16:2529680-2529702 CTGTGCGGCCGCCCTGGAGGCGG + Intronic
1132986452 16:2770029-2770051 CTCTGGGGACCCAAGGGAGGGGG - Intronic
1133828850 16:9303134-9303156 CTGTCGGGTGGCGGGGGAGGAGG + Intergenic
1134930759 16:18205891-18205913 CTGTGGGGACTCGGGGGAAAGGG + Intergenic
1136270648 16:29146382-29146404 CTGTGGGGACGCGGGGATGGAGG + Intergenic
1136270665 16:29146442-29146464 CTGTGGGGACGCGGGGACGGGGG + Intergenic
1137060528 16:35788759-35788781 CGGTTGGGTCCCGCGGGAGGAGG + Intergenic
1140223332 16:73058987-73059009 CGGAGGGGACGCGCTGGAAGTGG + Intronic
1141972430 16:87492711-87492733 CTGGGCGGAGGCGCGGGCGGCGG - Intergenic
1142074244 16:88108223-88108245 CTGTGGGGATGCGGGGAGGGGGG + Intronic
1142130353 16:88429227-88429249 CAGTGGGGACTCGCTGGGGGAGG - Exonic
1142198960 16:88752044-88752066 CTGTGGGGAGGCCAGGGAGGTGG + Intronic
1142502499 17:340621-340643 ATGTGGGGAGGCCTGGGAGGGGG - Intronic
1142502574 17:340837-340859 ATGTGGGGAGGCCTGGGAGGGGG - Intronic
1142502612 17:340944-340966 ATGTGGGGAGGCCTGGGAGGGGG - Intronic
1142502637 17:341015-341037 ATGTGGGGAGGCCTGGGAGGGGG - Intronic
1142502659 17:341085-341107 ATGTGGGGAGGCCTGGGAGGGGG - Intronic
1142761557 17:2045013-2045035 GTGTGGGGAGGGGTGGGAGGTGG + Intergenic
1144955405 17:19016610-19016632 CTGTTGGGACACGCCAGAGGCGG + Intronic
1146058594 17:29593202-29593224 CTGTGGGGACCCGGGGGCTGCGG + Intronic
1147167531 17:38601455-38601477 CTGGGGGGCCGCGCGGTTGGAGG + Intronic
1148323841 17:46772081-46772103 GTGTGGGGACTCGCCGGGGGCGG + Intronic
1148391402 17:47275652-47275674 CTGGGGGGAGGGGCGGGAGCTGG + Intronic
1148675513 17:49442536-49442558 CTGGGGGGACTCTAGGGAGGAGG + Intronic
1149201477 17:54190684-54190706 TTGTGGGGAAGAGCGGGAGGGGG - Intergenic
1149571322 17:57674265-57674287 CAGTGGGGAGGGGCGGGTGGTGG + Intronic
1150290691 17:63979778-63979800 CTTTGGGAAAGCGAGGGAGGAGG + Intergenic
1150561905 17:66302293-66302315 GAGTGGGGATGCGGGGGAGGAGG - Intergenic
1151718609 17:75843759-75843781 CTCTGGGGAAGGGAGGGAGGTGG - Intronic
1151743127 17:75997353-75997375 CTGTGGTGGCGCCGGGGAGGGGG - Intronic
1152197380 17:78925500-78925522 CTGGGGGGAGGCGCGGGCGGAGG - Intergenic
1152245449 17:79182762-79182784 CTCCGGGGAGGCGGGGGAGGTGG - Intronic
1152352512 17:79791471-79791493 CTGCGGGGACTCGGGGGCGGGGG + Intergenic
1152930689 17:83108044-83108066 CTGAGGGCAAGCGCAGGAGGTGG + Intergenic
1153002969 18:473183-473205 CTGTGGGCTTGCGGGGGAGGTGG - Intronic
1153040836 18:812082-812104 CGGTGGGGCCCCGCGGGCGGAGG - Intronic
1153427499 18:4982223-4982245 CTTTGGGGAAGAGTGGGAGGGGG + Intergenic
1153489027 18:5629598-5629620 CTGGGGAAACGCGGGGGAGGGGG - Intronic
1154051284 18:10961405-10961427 TTGTGGGGAAGTGTGGGAGGAGG + Intronic
1157763593 18:50282017-50282039 CTGTGGGAGCGCGCGGGGCGGGG + Intergenic
1160757460 19:765140-765162 CTGTGGGGACCCTGGGGAGGCGG + Intergenic
1160789900 19:918518-918540 CGGTGGGGATGCGCGGGCGCTGG - Intronic
1160823335 19:1068151-1068173 CTGCGGGGAGGCGCGGGAGGGGG - Intronic
1160948776 19:1655757-1655779 CTCTGGGGCCGGGCAGGAGGAGG + Intergenic
1161141560 19:2651167-2651189 CAGTGGGGAGGGCCGGGAGGCGG - Intronic
1161156120 19:2732663-2732685 CTTGGGGGACGCGCGGCCGGGGG + Exonic
1161573458 19:5042804-5042826 CGGTGGGGCCGGGTGGGAGGTGG - Intronic
1161775841 19:6261581-6261603 CTGTGGTGACACCTGGGAGGAGG + Intronic
1162312116 19:9913850-9913872 CGGCGCGGAGGCGCGGGAGGGGG - Intronic
1162918181 19:13885360-13885382 CTGTGGGAGGGCACGGGAGGAGG + Intronic
1163529160 19:17839612-17839634 CTGTGGGGCTGCGCCGGATGAGG + Exonic
1163556071 19:17993467-17993489 CTGTGGGGACACGGGGTTGGGGG - Intronic
1165249124 19:34515537-34515559 CTGAGGGGACAGGCGGGGGGGGG - Intergenic
1166107289 19:40603729-40603751 CTGTGCGGAGGGGAGGGAGGAGG - Intronic
1166219041 19:41353675-41353697 CTGCGGGGAGGAGGGGGAGGAGG - Exonic
1167076178 19:47250908-47250930 CTGTGGGGAGGCGGGGGAGGCGG - Intergenic
1167486740 19:49767221-49767243 CACTGGAGACGCGGGGGAGGGGG + Intronic
1167622655 19:50568039-50568061 CTGCGGGGAGGCGCGGGGGGCGG + Intronic
1167851033 19:52202062-52202084 ATGTGGGGACTCTTGGGAGGTGG + Intronic
925047615 2:785973-785995 CTGTGGGAAAAAGCGGGAGGTGG + Intergenic
928386289 2:30871402-30871424 CTGTGGGGAGGGGCGCCAGGGGG - Intergenic
930728732 2:54708596-54708618 CAGTGGGGAGGCGCAGGCGGTGG + Intergenic
932435512 2:71700674-71700696 GTGGGGGGAGGCGGGGGAGGGGG + Intergenic
936059291 2:109283947-109283969 GTGTGGGGACAGGAGGGAGGCGG - Intronic
936250868 2:110867161-110867183 CTGTGGGGATCCGGGGGATGAGG + Intronic
936267788 2:111023553-111023575 GTGTGGGGACGTGTGGGAGAAGG + Intronic
937907745 2:127060641-127060663 CTGTGGGGACGGACGGGAGGTGG + Intronic
938253263 2:129833031-129833053 CTGTGGGGGGGGGGGGGAGGAGG - Intergenic
938468352 2:131537052-131537074 CTGTGAGGACGGGCGTGCGGTGG - Intergenic
939344803 2:140950373-140950395 CTGTGGGGACGGGAGTGATGAGG - Exonic
941043398 2:160648169-160648191 CAGTGGGGAGGCGCAAGAGGCGG + Intergenic
941762871 2:169264093-169264115 TTGTGGGGTGGCGCGGGAGGAGG + Intronic
944507308 2:200425764-200425786 CTTTGGGGTCGCGGGGGATGGGG + Intronic
944916907 2:204370247-204370269 CTGTGGGGAGGAGGGGGAGGTGG - Intergenic
947724026 2:232386543-232386565 CAGTGGCAGCGCGCGGGAGGAGG - Intergenic
948190139 2:236051915-236051937 TTGAGGGGACGTGCAGGAGGTGG - Intronic
948230772 2:236347699-236347721 CTGTGGGGAAGAGTGGGAGGGGG + Intronic
948724983 2:239929050-239929072 CAGTGGGAAGGCACGGGAGGGGG - Intronic
948803232 2:240442161-240442183 CTGTGGGGAAAGGCCGGAGGAGG - Intronic
1169116067 20:3066822-3066844 CTGTGGGGAAACTAGGGAGGAGG - Intergenic
1170748721 20:19124699-19124721 CTGTGGGGGGGCGGGGGCGGGGG - Intergenic
1171869562 20:30514231-30514253 CTGTGGGGCTGCAGGGGAGGGGG + Intergenic
1173474037 20:43345973-43345995 CTGTGGGGTTGCCCGGAAGGGGG + Intergenic
1174317528 20:49713933-49713955 CGGGGCGCACGCGCGGGAGGCGG + Intergenic
1174460409 20:50678397-50678419 CTGTGGGGTGGGGTGGGAGGTGG - Intronic
1176234973 20:64049798-64049820 CTGAGAGGTCGCGGGGGAGGTGG - Intergenic
1180156926 21:45982462-45982484 CGGTGGGGACGGTGGGGAGGGGG - Intronic
1180707477 22:17818275-17818297 CGGTGGGGGCGGGCTGGAGGGGG + Exonic
1181366438 22:22380561-22380583 CTGAGAAGACGCGCGGGGGGCGG + Intergenic
1181793030 22:25282718-25282740 CTGGGGGGCGGCGCGCGAGGCGG + Intergenic
1182772544 22:32805620-32805642 CTGTGGGGGGTCGGGGGAGGGGG - Intronic
1184023077 22:41833677-41833699 GTGTGGGCGCGCGAGGGAGGCGG - Intronic
1185279444 22:49963693-49963715 CAGTGGGGAGGCAGGGGAGGGGG + Exonic
1185333278 22:50261045-50261067 CTGTGGGGCCGGGCGGGGGTCGG - Intronic
1185333547 22:50261858-50261880 CTGGGGGGAAGCGCAGGGGGAGG + Intergenic
953756190 3:45647817-45647839 CTGTGGGGCAGCGGAGGAGGGGG - Intronic
954005693 3:47588701-47588723 CTGTGGGGGCGGGGGGGGGGCGG - Intronic
954806800 3:53225295-53225317 CTGTGGGGACTTGGGGGAGGTGG + Intronic
955852068 3:63231311-63231333 CTCTGGGGACTGGTGGGAGGAGG + Intronic
957232705 3:77540572-77540594 CAGTGGGGGCGCGCAGGGGGAGG + Intronic
958798938 3:98733818-98733840 CAGTGGGGAGGAGCAGGAGGGGG + Intronic
961083027 3:124042699-124042721 CTGTGGGGAGGCAGGGGAAGAGG + Intergenic
961093432 3:124135370-124135392 TTGTGGGGAAGAGTGGGAGGGGG + Intronic
961574465 3:127823251-127823273 GGGTGGGGACGCGCGGGACCCGG + Intergenic
962038530 3:131680827-131680849 CTGTGGGGACGCAGGGGAAAGGG - Intronic
964190456 3:153994393-153994415 CTGGGGGGAAGAGTGGGAGGGGG + Intergenic
964344846 3:155745096-155745118 CTGCGGGGCCGAGAGGGAGGGGG - Intergenic
965216373 3:165869335-165869357 TTGTGGGGAAGAGTGGGAGGGGG - Intergenic
967054754 3:185822835-185822857 CTGGGGGTAGGGGCGGGAGGTGG + Intronic
968236703 3:197035780-197035802 CCCTGGGGATGGGCGGGAGGAGG + Intergenic
968471969 4:786572-786594 CTGCGGGGACGAGGTGGAGGAGG - Exonic
968491722 4:893752-893774 CTATGGTGACGGGCGGGAGTGGG + Intronic
969057900 4:4413590-4413612 CAGTGGGGACGTGCTGGTGGGGG + Intronic
969379015 4:6782515-6782537 CTGCGGGCGCGCGCGGGCGGTGG - Intronic
969645793 4:8428199-8428221 CTGTGAGGATTCGCGGGCGGGGG - Intronic
971513177 4:27453313-27453335 TTGTGGGGAAGAGAGGGAGGGGG - Intergenic
973613268 4:52657369-52657391 GTGGGGGGACGCGTGGGGGGAGG + Intronic
980930173 4:139177142-139177164 CGGTGGGGCGGCGCGGGCGGGGG - Exonic
981375775 4:144013766-144013788 CTGTGGGGTTGGGGGGGAGGGGG + Intronic
981922334 4:150098936-150098958 CTTTGGGGAGCCGAGGGAGGTGG - Intronic
982292554 4:153793039-153793061 CTGAAGGGGCGCGCTGGAGGAGG + Intergenic
982455181 4:155601391-155601413 CTGTGGGAAAGGGTGGGAGGAGG - Intergenic
982962097 4:161852833-161852855 CTGTTGGGGTGCGTGGGAGGAGG + Intronic
983921440 4:173349834-173349856 CAGTGGGGACGGGAGGGAGTGGG + Intergenic
984312131 4:178074941-178074963 TTGTGGGGTGGCGGGGGAGGGGG + Intergenic
985377537 4:189356477-189356499 CTGGGGGGACGCACAGGAGATGG + Intergenic
985540308 5:484462-484484 GTGTGGAGAAGCTCGGGAGGAGG + Intronic
985632519 5:1021419-1021441 CTGTGGGGAGGGGCTGGGGGGGG - Intronic
985691731 5:1316702-1316724 CTGGGGGGGCACACGGGAGGCGG - Intergenic
986321374 5:6634412-6634434 CTGTGGGGGCGGGGGGGAGGGGG + Intronic
986826925 5:11532157-11532179 CTGTAGGGAGGCTCTGGAGGTGG - Intronic
986918351 5:12653712-12653734 CTTTGGGGAAGAGTGGGAGGGGG + Intergenic
987549411 5:19359507-19359529 CTTTGGGAAAGCGCGGCAGGCGG - Intergenic
987865902 5:23538337-23538359 CAGTGGGGAAGAGTGGGAGGAGG - Intergenic
987959420 5:24786220-24786242 ATGTGGGGGCGAGGGGGAGGGGG - Intergenic
989623835 5:43410678-43410700 CTGTGGGGACAGGTGGGAGTAGG + Intronic
991186900 5:63819168-63819190 CTTTGGGGAGGCGAGGCAGGAGG + Intergenic
991970190 5:72133338-72133360 CTGAGGTGAGGCGCTGGAGGCGG + Intronic
992910734 5:81393948-81393970 CTGCGGGGAGGCGCGGGACCGGG - Intronic
993945352 5:94111536-94111558 CTGAGGGGGCAGGCGGGAGGAGG + Exonic
996765453 5:127030734-127030756 CTGGCGGGACGCGCCGGCGGCGG + Exonic
997303660 5:132823872-132823894 CTGTGGGGAGGCTGGAGAGGAGG - Exonic
998353210 5:141514271-141514293 CCGGGGGGACGGGAGGGAGGCGG + Intergenic
999062762 5:148653988-148654010 CGGTGGGGACGCGGCGGGGGCGG - Intronic
999982683 5:156972962-156972984 TTGTGGGGAAGAGTGGGAGGAGG - Intergenic
1000282055 5:159790681-159790703 TTGTGGGGAAGAGTGGGAGGGGG - Intergenic
1001458102 5:171882933-171882955 TTGGGGGGACGAGTGGGAGGGGG - Intronic
1001960906 5:175879952-175879974 CTGCGGGGACGAGGAGGAGGAGG + Exonic
1002094521 5:176823172-176823194 ATGTGGGGGGGCGAGGGAGGGGG + Intronic
1002172149 5:177381348-177381370 GTGTGGGAAGGAGCGGGAGGCGG - Intronic
1002186279 5:177456197-177456219 CTGCGGGGAGGGGCGGGGGGAGG + Exonic
1003049147 6:2764992-2765014 CTGTGGGGACAAGCAGGAGGCGG - Intergenic
1003175897 6:3751974-3751996 CTCCGGGGCCGCGAGGGAGGAGG - Exonic
1003257901 6:4490037-4490059 CCGTGGGGACTCCTGGGAGGGGG + Intergenic
1004433680 6:15569354-15569376 CTGTCGGGGCGGGCGGGGGGGGG - Intronic
1005253416 6:23972945-23972967 CAGTGGGGACGCTCGTGATGTGG + Intergenic
1006394778 6:33780180-33780202 CTGTGGGAGGGCGCGGGAGAAGG + Intronic
1007278511 6:40693082-40693104 GTGTGGGGGCGAGAGGGAGGGGG - Intergenic
1007361365 6:41358703-41358725 CTATGGGGGCGGGCGGGGGGTGG - Intergenic
1007664916 6:43508465-43508487 TTGTGGGGAAGGGCTGGAGGAGG - Intronic
1007761512 6:44136101-44136123 CAGTGGGGACTTGAGGGAGGAGG - Intronic
1007785207 6:44275906-44275928 CTGTGTTGACCCGCGGCAGGCGG - Exonic
1008403780 6:51096219-51096241 CTGTGGGGATGCTTTGGAGGTGG + Intergenic
1010415033 6:75602439-75602461 ATGAGGGGCCGCGCCGGAGGAGG - Exonic
1010703477 6:79078423-79078445 CTGCGGGGAGGAGCGGGTGGGGG - Intergenic
1011410271 6:87059815-87059837 CTGGGGGGAGGCGGGGGAGGCGG + Intergenic
1013236117 6:108198962-108198984 CTGTAGGGATGCGGAGGAGGTGG + Intergenic
1013721191 6:113030185-113030207 TTGTGGGGAAGAGTGGGAGGGGG + Intergenic
1014348019 6:120300112-120300134 CTGTAGGGAGGGGCTGGAGGTGG + Intergenic
1015149040 6:130019143-130019165 CTCGGGGGGCGCGGGGGAGGGGG - Intronic
1016167258 6:140962115-140962137 CTTTGGGGACTCGAGGGAGAGGG - Intergenic
1018034022 6:159866629-159866651 CTGTGCGGGGGCTCGGGAGGTGG + Intergenic
1019276706 7:179658-179680 CCGTGGGGCCGCCCGGGAGGAGG + Intergenic
1019333917 7:473728-473750 CTGTGGGGTGGGGCGTGAGGGGG - Intergenic
1019738196 7:2660641-2660663 CTGTGGGGACGCCACGGAGGGGG - Intronic
1022094408 7:27130084-27130106 CGCTTGGGAGGCGCGGGAGGTGG - Intronic
1023159207 7:37281224-37281246 TTGGGGGGAAGAGCGGGAGGGGG + Intronic
1025149533 7:56537957-56537979 CTGGAGGGACGCGGAGGAGGAGG + Intergenic
1026522789 7:71131667-71131689 CGGAGGGGACGCGCAGGTGGCGG - Intergenic
1026632959 7:72053785-72053807 CTGGGGGGAAGGGTGGGAGGGGG - Intronic
1026935738 7:74254344-74254366 CTGTGGTGGCGCGGGCGAGGTGG - Exonic
1027540080 7:79454487-79454509 CTGGCGGGACGCGCGGGCGGGGG - Intergenic
1028182460 7:87742352-87742374 TTGTGGGGAAGAGTGGGAGGGGG - Intronic
1029110641 7:98211587-98211609 CTGTGGGGAAACCCGGGTGGGGG + Intronic
1029294156 7:99526210-99526232 CTGTGTGGACGCGCTGGTGCTGG - Exonic
1029720955 7:102364104-102364126 CAGAGGGGCCGGGCGGGAGGTGG + Exonic
1029821166 7:103149169-103149191 CTGTTGGACCTCGCGGGAGGCGG - Exonic
1033367222 7:140680963-140680985 CTGTGGTGCCACGTGGGAGGAGG + Intronic
1034572444 7:151967772-151967794 GCGTGGGGACGGGAGGGAGGTGG - Intronic
1034680817 7:152925950-152925972 CTGTGGGGCTGCCCGGGAGGGGG - Intergenic
1035535472 8:387575-387597 CTGTGGGGTCCCGAGGGAAGCGG + Intergenic
1037887991 8:22605003-22605025 CCTTGGGGGCGGGCGGGAGGAGG + Intronic
1037914093 8:22761392-22761414 CTGGGGGGAGGCGGGGAAGGCGG + Intronic
1039419072 8:37420463-37420485 CAGTGGGCAGGCGGGGGAGGGGG - Intergenic
1039635983 8:39166194-39166216 CTGGGGGGAAGAGTGGGAGGTGG - Intronic
1040080104 8:43276201-43276223 CTGTGGGGGCGGGCGGGGTGAGG + Intergenic
1040661535 8:49582098-49582120 CAGTGCGGAGGCGCGGGTGGTGG + Intergenic
1041172975 8:55164188-55164210 CTGTGGGGAGGCGGCGGACGAGG - Exonic
1041434466 8:57822483-57822505 CTTTGGGGACGCGGGGGAAAGGG + Intergenic
1041686850 8:60652309-60652331 CCCTGGGCACGCGCAGGAGGTGG - Intergenic
1045488796 8:102654675-102654697 CCGTGGAGACGCGCGGCGGGAGG - Intronic
1049034221 8:140061939-140061961 ATGTGGAGATGCGTGGGAGGTGG - Intronic
1049298898 8:141859308-141859330 CTGTGGGGATGCCCTGGGGGAGG + Intergenic
1049485487 8:142856987-142857009 CCGTGGGGAGGGGGGGGAGGGGG + Intronic
1049545803 8:143229961-143229983 CTGTGGGAACTCGCTGGAGAAGG + Intergenic
1049800999 8:144517509-144517531 CTGCGTGGGCGAGCGGGAGGCGG + Intronic
1051604590 9:18907370-18907392 CTGTGGGGTTGGGAGGGAGGGGG - Intronic
1052347072 9:27420787-27420809 CTGGGGGGAAGAGTGGGAGGGGG + Intronic
1052777536 9:32747822-32747844 CTTTGGGGATGAGTGGGAGGGGG - Intergenic
1056135169 9:83623508-83623530 CTGCGGGGCCGCGCAGGTGGAGG + Intronic
1056322228 9:85446485-85446507 CTGAGGGGAAGAGTGGGAGGTGG - Intergenic
1056982137 9:91324257-91324279 CTGTGGGAAGACGAGGGAGGAGG + Intronic
1057054542 9:91950307-91950329 CCGGGGGAACGCGCGGGCGGCGG + Intergenic
1058084493 9:100733947-100733969 TTGTGGGGAAGAGTGGGAGGAGG - Intergenic
1060225628 9:121788665-121788687 CTGTGCAGAGGAGCGGGAGGAGG - Intergenic
1060397799 9:123328174-123328196 CTGTGGGGAGAGGCGGGGGGGGG + Intergenic
1060661512 9:125407878-125407900 CTGTGGTGGCGCGGGGGACGGGG + Intergenic
1061722066 9:132557972-132557994 CCGTGGGCACGGGAGGGAGGTGG - Intronic
1061828368 9:133275376-133275398 CCTTGGGGATGCGCGCGAGGAGG - Intergenic
1061913649 9:133738064-133738086 TTGTGGGGAGGAGCGGCAGGGGG + Intronic
1062638239 9:137502692-137502714 CGGGGGGGACGCGGGGGACGCGG + Intronic
1185462850 X:340485-340507 GTGAGGGGACGGACGGGAGGGGG - Intronic
1185462866 X:340519-340541 GTGAGGGGACGGACGGGAGGGGG - Intronic
1185462882 X:340553-340575 GTGAGGGGACGGACGGGAGGGGG - Intronic
1186795669 X:13044505-13044527 CGGTGGGGATGCGGGGAAGGCGG - Intronic
1186933254 X:14418272-14418294 TTGTGGGGAGGGGGGGGAGGGGG - Intergenic
1187061858 X:15794326-15794348 CTGTGGGGAGGGGCGGGGGGCGG - Intronic
1188112808 X:26212095-26212117 CTGTGGGGAAGGGTGGGGGGTGG + Intergenic
1190048548 X:47132085-47132107 CTCTGGGGACTGGGGGGAGGGGG - Intergenic
1190554274 X:51618132-51618154 CGGTGGCGACCCGGGGGAGGAGG - Intergenic
1190560569 X:51682090-51682112 CGGTGGCGACCCGGGGGAGGAGG - Intergenic
1190563722 X:51711231-51711253 CGGTGGCGACCCGGGGGAGGAGG + Intergenic
1192473707 X:71420885-71420907 CGGTGGGGAGGCCGGGGAGGGGG - Intronic
1195686542 X:107592083-107592105 TTGCGGGGAAGGGCGGGAGGGGG - Intronic
1196819672 X:119692877-119692899 CGGTGGTGGCGCGCGGGGGGCGG - Intronic
1197120570 X:122886115-122886137 CTTTGGGGACTCGGGGGAAGTGG + Intergenic
1197147494 X:123185485-123185507 CTGTGCGGATGGGCGGGGGGCGG + Intronic
1197233303 X:124029951-124029973 GGGTGGGGACGCGCGGGTAGGGG - Intronic
1198394610 X:136208927-136208949 CTGGGGGGAGGGGTGGGAGGAGG + Intronic
1199640780 X:149858891-149858913 CTGTGGCGGCACGGGGGAGGGGG - Intergenic
1201714264 Y:17026902-17026924 TTGTGGGGAAGAGTGGGAGGGGG + Intergenic