ID: 1094564923

View in Genome Browser
Species Human (GRCh38)
Location 12:31590802-31590824
Sequence GAGCTGCGCGGCGCCCGGCC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 329
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 301}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094564923_1094564936 27 Left 1094564923 12:31590802-31590824 CCGGGCCGGGCGCCGCGCAGCTC 0: 1
1: 0
2: 1
3: 26
4: 301
Right 1094564936 12:31590852-31590874 GGGCCGCCGCCGCCGCCGCCCGG 0: 4
1: 18
2: 123
3: 318
4: 969
1094564923_1094564926 -10 Left 1094564923 12:31590802-31590824 CCGGGCCGGGCGCCGCGCAGCTC 0: 1
1: 0
2: 1
3: 26
4: 301
Right 1094564926 12:31590815-31590837 CGCGCAGCTCCCGCTCATCCCGG 0: 1
1: 0
2: 0
3: 5
4: 116
1094564923_1094564930 6 Left 1094564923 12:31590802-31590824 CCGGGCCGGGCGCCGCGCAGCTC 0: 1
1: 0
2: 1
3: 26
4: 301
Right 1094564930 12:31590831-31590853 ATCCCGGCCGCGCTGCTCCAGGG 0: 1
1: 0
2: 0
3: 4
4: 76
1094564923_1094564929 5 Left 1094564923 12:31590802-31590824 CCGGGCCGGGCGCCGCGCAGCTC 0: 1
1: 0
2: 1
3: 26
4: 301
Right 1094564929 12:31590830-31590852 CATCCCGGCCGCGCTGCTCCAGG 0: 1
1: 0
2: 1
3: 14
4: 148
1094564923_1094564937 28 Left 1094564923 12:31590802-31590824 CCGGGCCGGGCGCCGCGCAGCTC 0: 1
1: 0
2: 1
3: 26
4: 301
Right 1094564937 12:31590853-31590875 GGCCGCCGCCGCCGCCGCCCGGG 0: 4
1: 40
2: 220
3: 511
4: 1384
1094564923_1094564931 7 Left 1094564923 12:31590802-31590824 CCGGGCCGGGCGCCGCGCAGCTC 0: 1
1: 0
2: 1
3: 26
4: 301
Right 1094564931 12:31590832-31590854 TCCCGGCCGCGCTGCTCCAGGGG 0: 1
1: 0
2: 0
3: 7
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094564923 Original CRISPR GAGCTGCGCGGCGCCCGGCC CGG (reversed) Exonic
900122426 1:1054504-1054526 CAGCTGCGTGGCGCCCAGCGGGG - Exonic
900159668 1:1217486-1217508 GGGCGGCGCGGGGCGCGGCCGGG + Exonic
900226287 1:1535010-1535032 GGGCGGCGAGGCGCGCGGCCCGG - Intergenic
900228470 1:1543839-1543861 GCCCAGCGCGGCGCCCAGCCGGG + Intronic
900283795 1:1890085-1890107 GGGTTGCGCGGACCCCGGCCCGG - Intronic
900357391 1:2271398-2271420 GAGCCGCGTGGCGCCTGGGCTGG + Intronic
900408343 1:2502182-2502204 CTGCTGGGCGGCCCCCGGCCCGG + Exonic
900415029 1:2530887-2530909 GAGCTGCCCGGAGCCCAGCCAGG - Intergenic
901332761 1:8423720-8423742 GGGCCGCGCGGCGCGGGGCCCGG + Intronic
902336733 1:15758607-15758629 GGGCGGCGCGGGGCGCGGCCGGG + Intronic
903217864 1:21852975-21852997 GAACTGCGTGGTGCCCGGGCAGG - Exonic
903384356 1:22916834-22916856 GAGCTGTGCAGCGCCAGGCTGGG + Intergenic
904158612 1:28505552-28505574 GAGGTGCGCGGCACCATGCCTGG + Intergenic
904181369 1:28668904-28668926 GGGCCGCGCGGCGGCCGGCGAGG + Intronic
906719975 1:47997396-47997418 GAGCGGCGCGGAGCCGGGCCGGG + Intergenic
910963381 1:92784811-92784833 GAGGGGCGCTGCGCCAGGCCGGG - Intronic
912514745 1:110210652-110210674 GTCCTGCGCGGCGCCGAGCCTGG - Intergenic
915143922 1:153783547-153783569 GAGCTGCGAGGCACCCGGGGCGG + Intergenic
919748714 1:201023768-201023790 GGGCGGGGCGGGGCCCGGCCTGG - Intergenic
920886884 1:209938158-209938180 GAGAGGGGCGGGGCCCGGCCCGG - Intronic
921199629 1:212792396-212792418 GAGATGCGCAGCGCCCGCCTCGG - Intronic
922648600 1:227318065-227318087 GAGCCGCGCCGCGCCGCGCCGGG + Exonic
923506193 1:234608808-234608830 GGGCTGCGCGGAGCCCAGGCTGG + Exonic
924090109 1:240492943-240492965 GGGCTGAGCTGCGTCCGGCCCGG + Exonic
924511310 1:244730876-244730898 GTGCTGCGCGCCGCCGCGCCGGG + Intergenic
1063983265 10:11473602-11473624 GAGCTGCAAGGCGCAGGGCCAGG + Intronic
1064202955 10:13299936-13299958 GGGCTGCGCGGGGCTCGGGCTGG - Intronic
1067498088 10:46776368-46776390 CAGCTGCGCGGGCCCCCGCCTGG - Intergenic
1067596558 10:47564046-47564068 CAGCTGCGCGGGCCCCCGCCTGG + Intergenic
1068767389 10:60778675-60778697 GATCTGCGCGGGGCCCGGCTGGG + Intronic
1069849607 10:71396701-71396723 GAGCGGCGCCGAGCCCCGCCGGG - Intergenic
1070592410 10:77810503-77810525 GAGCTGCACAGCGTCCAGCCTGG - Intronic
1070835529 10:79445087-79445109 GAGCCGGGCCGCGCCAGGCCAGG + Intronic
1072071672 10:91923985-91924007 GAGCTGAGCGGCGCAGGCCCAGG - Exonic
1072421081 10:95291007-95291029 GAGCGGCGCGGCGCGGGCCCGGG + Exonic
1072578489 10:96720639-96720661 GAGCTGGCCGGCGGCCGGCATGG - Intergenic
1073363301 10:102917709-102917731 CACCTGCGCGGCGCTCCGCCGGG - Intergenic
1076035649 10:127196619-127196641 GGGCGGCGCGGGGCCGGGCCGGG + Intronic
1076882469 10:133246209-133246231 AAGCTGCGGGGCCCCCGCCCAGG + Intergenic
1076949748 10:133670938-133670960 GTGCAGCGCGGCCCCCGGCGGGG + Intronic
1076950732 10:133674237-133674259 GTGCAGCGCGGCCCCCGGCGGGG + Intergenic
1076951722 10:133677547-133677569 GTGCAGCGCGGCCCCCGGCGGGG + Intergenic
1076952711 10:133680857-133680879 GTGCAGCGCGGCCCCCGGCGGGG + Intergenic
1076953695 10:133684156-133684178 GTGCAGCGCGGCCCCCGGCGGGG + Intergenic
1076955668 10:133743818-133743840 GTGCAGCGCGGCCCCCGGCGGGG + Intergenic
1076956658 10:133747128-133747150 GTGCAGCGCGGCCCCCGGCGGGG + Intergenic
1076957645 10:133750437-133750459 GTGCAGCGCGGCCCCCGGCGGGG + Intergenic
1076959619 10:133757046-133757068 GTGCAGCGCGGCCCCCGGCGGGG + Intergenic
1076960603 10:133760345-133760367 GTGCAGCGCGGCCCCCGGCGGGG + Intergenic
1077306393 11:1870486-1870508 GAGCTCTGGGGTGCCCGGCCTGG - Intronic
1077962546 11:7089982-7090004 GAGCTGCGCGGCGCCGCCCCAGG + Exonic
1078245913 11:9573439-9573461 GGGCGGCGGGGGGCCCGGCCCGG - Intergenic
1079128568 11:17735073-17735095 GAGCTGCACGGGGCCAGGCGGGG - Exonic
1082044577 11:47714791-47714813 GAGCTGGGGGGCGCCCGGGGAGG - Intronic
1083176147 11:60951559-60951581 GAGCCGCGGGGGGCCCAGCCCGG - Exonic
1083560915 11:63672112-63672134 GTGAGGCACGGCGCCCGGCCTGG - Intergenic
1084086447 11:66857313-66857335 GCGCAGCGCGGGGGCCGGCCAGG + Intronic
1084275214 11:68047823-68047845 GTGCTGCGGGGCCCCCAGCCGGG - Intronic
1084676293 11:70637444-70637466 GAGCTGGCCGTGGCCCGGCCAGG - Intronic
1084887707 11:72221802-72221824 GAGCTGAGCTGAGCCCAGCCTGG - Exonic
1084888480 11:72224993-72225015 GGCCTGCGGGGCGCCGGGCCCGG + Exonic
1085294831 11:75425486-75425508 GAGGGGCGCGGCGGCCGCCCAGG + Exonic
1092208391 12:6630837-6630859 GAGCTGCCAGGCCCCTGGCCTGG + Intronic
1094564923 12:31590802-31590824 GAGCTGCGCGGCGCCCGGCCCGG - Exonic
1095465421 12:42483707-42483729 GAGCTCGGCGGGGACCGGCCGGG - Intronic
1096116947 12:49060391-49060413 GAGCTGCCCCGCCCCCGGCCTGG + Intergenic
1096699347 12:53371834-53371856 GAGCTGGGCCGGGCCGGGCCGGG + Intergenic
1096774380 12:53955282-53955304 GAGCAGCGCTGCCCCGGGCCCGG - Exonic
1103534723 12:121626697-121626719 GTGCCTCGCGGCGCCCGGGCCGG + Exonic
1104001491 12:124863461-124863483 GTGCTCTGCGGCGCCAGGCCCGG + Intronic
1104666197 12:130649304-130649326 GAGCGGAGCGGCCTCCGGCCGGG - Intronic
1104692764 12:130839109-130839131 GAGCGGCGGGGCGCGCTGCCCGG - Exonic
1104869132 12:131982105-131982127 GAGCTGCGCGGCCTGCGGCGTGG - Exonic
1104887417 12:132118844-132118866 GAGCTGCGCGGCGTGCGGCGTGG - Intronic
1107058451 13:36131063-36131085 GAGCTGCGGGGAGGGCGGCCGGG - Intronic
1112771413 13:102798899-102798921 GAGCAGCGCGGTTCTCGGCCGGG - Exonic
1113655794 13:112067279-112067301 GCGGTGCGCTGGGCCCGGCCCGG - Intergenic
1113820549 13:113209558-113209580 GAGCTCCGCTCCGCCCGCCCCGG - Exonic
1117253576 14:53956766-53956788 AAGGAGCGCGGAGCCCGGCCCGG - Exonic
1118854740 14:69611998-69612020 CAGCGGCGCGGCTCGCGGCCGGG - Intronic
1119484388 14:74978411-74978433 GAGCTGGTCTGCGCCTGGCCTGG - Intergenic
1119778164 14:77260824-77260846 GGGCTGCACGGGGCCCCGCCAGG + Intergenic
1122558054 14:102592148-102592170 AAGCCGCGGAGCGCCCGGCCGGG - Intergenic
1122716897 14:103701287-103701309 GAGCGCTGCGGCTCCCGGCCAGG - Intronic
1124190839 15:27574830-27574852 GCGCTCCGCGGCTCCCAGCCTGG - Intergenic
1130531010 15:84748228-84748250 GAGCCGGGCGGGGGCCGGCCGGG + Intergenic
1131071694 15:89470216-89470238 AAGGTGCGCGGCGCTCGGCAGGG - Intergenic
1132641759 16:981454-981476 GAGCCGCGCGGCGCCCGCAGAGG + Intergenic
1132716317 16:1291874-1291896 GGGCTGAGCGGCGCCCACCCAGG - Intergenic
1132816160 16:1827598-1827620 GAGCTTCACGGCGTCCTGCCCGG + Exonic
1133271965 16:4614658-4614680 GAGGTGCGCGGCGCCGGAGCCGG - Exonic
1134615719 16:15650080-15650102 TGGCCGCGCCGCGCCCGGCCTGG + Intronic
1136707677 16:32202540-32202562 GAGCGGGGCGGGGCCCGGGCCGG + Intergenic
1136760233 16:32726870-32726892 GAGCGGGGCGGGGCCCGGGCCGG - Intergenic
1136807871 16:33143516-33143538 GAGCGGGGCGGGGCCCGGGCCGG + Intergenic
1137618037 16:49858300-49858322 GAGCTGAGCGGGGCCGGGCCCGG - Intergenic
1138179264 16:54931133-54931155 GAGCCGGGCGGCGCCCTGCGAGG - Exonic
1140078502 16:71723508-71723530 GAGGCGGGCGGCGCGCGGCCAGG + Intronic
1140927716 16:79599668-79599690 CAGCTTCTCGGCGCCCAGCCCGG - Exonic
1141531137 16:84648149-84648171 GAGAGGCGCGGTGCCCGTCCCGG + Intergenic
1141972138 16:87491690-87491712 GGGCAGCGCGCCGCCCGGCCCGG + Exonic
1142280561 16:89145621-89145643 GAGCTGCGCCCGGCCAGGCCTGG - Intronic
1142406720 16:89894247-89894269 GGGCTGCGCGGGGGCCGTCCGGG - Intronic
1142406757 16:89894360-89894382 GGGCTGCGCGGGGGCCGTCCGGG - Intronic
1203062387 16_KI270728v1_random:987192-987214 GAGCGGGGCGGGGCCCGGGCCGG - Intergenic
1142550035 17:732711-732733 GCGCTGCGCCGCTCCCAGCCCGG + Exonic
1142586717 17:979038-979060 GTGCTGCGCTGCGCCCGCCCTGG - Intronic
1142711911 17:1728062-1728084 GGGCTGCCCGGGGCCGGGCCTGG + Exonic
1142887499 17:2921835-2921857 GAGCTGTGCAGTCCCCGGCCTGG - Intronic
1143078739 17:4366238-4366260 GGGCGGCGGGGCGCCGGGCCCGG - Intronic
1143174365 17:4947982-4948004 GAGGGGCGCGGCGCCCGGTGCGG - Intronic
1143742630 17:8965603-8965625 GAGGGGCTCGGCGCCCGGCGGGG - Exonic
1144758678 17:17694932-17694954 GAGATGCGCGCCGCCTGGCCCGG - Intronic
1145214720 17:21042906-21042928 GGGCTGCTCGGCGGCTGGCCAGG + Exonic
1146398701 17:32487428-32487450 GCGCGGCGCGGAGCCCAGCCTGG + Intronic
1146716197 17:35089055-35089077 GGGCCGCTGGGCGCCCGGCCTGG - Intronic
1147934731 17:44005087-44005109 GAGGTGAGCGGAGCCCGGCGTGG + Exonic
1148437259 17:47694225-47694247 GAGGGGAGCGGCGCCCGGGCTGG + Intronic
1149597828 17:57874581-57874603 GGGCAGCTCGGAGCCCGGCCAGG + Intronic
1150643487 17:66964682-66964704 GGGCTGCGCGGCCGCCGGGCGGG - Intergenic
1151783800 17:76265482-76265504 GCGCGGCGCGGCGCGGGGCCCGG - Exonic
1152082907 17:78199653-78199675 GTGCGCCGCCGCGCCCGGCCAGG + Intronic
1152251312 17:79214063-79214085 GAGCTGGGCGGCGCCATGCGAGG - Intronic
1152406493 17:80101210-80101232 GAGCTGCGGGGACCCAGGCCGGG + Intergenic
1152543986 17:80991800-80991822 GCGTTCCGCGGCGCCTGGCCCGG + Intronic
1152581173 17:81166185-81166207 GAGCCCCGCGGCGCCAGGGCCGG - Intergenic
1152649824 17:81487754-81487776 GAGCCGCGCCCCGCCTGGCCGGG - Intergenic
1155452315 18:25976032-25976054 GAGTTGCGCTGGGCCAGGCCCGG - Intergenic
1156447830 18:37250106-37250128 GAGCTGGGCGGGGCCAGGCTGGG + Intronic
1160236046 18:77087705-77087727 GAGCTGCCCGGGGCGCGCCCAGG - Intronic
1160541799 18:79628002-79628024 GAGCTGCCCAGCGCCCGCCAGGG + Intergenic
1160657467 19:280957-280979 GAGCTGCGCTGAGCCCAGCAGGG + Intergenic
1160930164 19:1566677-1566699 GAGCTGCGGGGCGGGCGGGCGGG - Intronic
1160930673 19:1568213-1568235 GGGCTGCTCGGGGCCGGGCCGGG + Intergenic
1160967616 19:1753535-1753557 AGGCTGCGCGGCGCACGGCCCGG - Exonic
1160967734 19:1753944-1753966 GGCCTGCGAGGCGCCGGGCCTGG + Exonic
1161069098 19:2251610-2251632 GCGCTGCGCTGTGCCCGACCCGG - Exonic
1161461946 19:4402843-4402865 GGGGGGCGCGGCGCGCGGCCTGG + Intronic
1161495003 19:4581694-4581716 GCGCTGCGCGGCGGCCGGACCGG + Intergenic
1162486063 19:10961195-10961217 GGGCAGCGCGGCGCGGGGCCGGG + Intronic
1162673961 19:12284435-12284457 GAGCTCCGCGGCCCCGGCCCCGG - Intronic
1162955907 19:14097734-14097756 GGGCTGCCCCTCGCCCGGCCTGG + Intronic
1163113822 19:15177796-15177818 GCGCTGCGAGGCGCCCGCCGCGG - Exonic
1163695695 19:18762212-18762234 GAGGTGCGCAGCTCCCGGGCGGG - Intronic
1163754537 19:19098775-19098797 CAGCTGCGCGCCACCCTGCCTGG - Intronic
1163783112 19:19260926-19260948 GAGCTGCAGGGCGACGGGCCTGG - Exonic
1164625375 19:29724175-29724197 GAGCTGCGCGGGGCAGGCCCGGG + Intergenic
1165058640 19:33194460-33194482 GAGCCCCGCCGCGGCCGGCCTGG - Intronic
1165172719 19:33905631-33905653 GACCTTCGCGGCGCCCCGACTGG + Intergenic
1165851457 19:38852226-38852248 GGGCGGCGCCGCGCGCGGCCGGG - Intronic
1166873861 19:45885779-45885801 GAGCTGGGCGGCGCGCGGACTGG - Exonic
1166948913 19:46413489-46413511 GAGCTGGGTGGCGGCCTGCCTGG - Exonic
1167359654 19:49023411-49023433 GAGCTGCCCGGGGCCGGGGCAGG - Intronic
1167361477 19:49032674-49032696 GAGCTGCCCGGGGCCGGGGCAGG + Intronic
1167362177 19:49036111-49036133 GAGCTGCCCGGGGCCAGGGCAGG - Intronic
1167363906 19:49044747-49044769 GAGCTGCCCGGGGCCCGGGCAGG + Intronic
1167364591 19:49048180-49048202 GAGCTGCCCGGGGCCGGGGCAGG - Intronic
1167365877 19:49054816-49054838 GAGCTGCCCGGGGCCCGGGCAGG - Intronic
925969050 2:9094279-9094301 GAGCTGCGCGGTGCCAGAGCAGG + Intergenic
927598889 2:24422970-24422992 GAGCTGCGTGGCTCCCTCCCTGG + Intergenic
927606685 2:24491925-24491947 GAGCTGCGCGGCCGCCTGCCCGG + Exonic
927679769 2:25131912-25131934 GTGCGGCGCGGGGCCGGGCCGGG + Intronic
927811805 2:26184656-26184678 GGGTTGCGCGGCGGCCGGCTGGG - Exonic
929188628 2:39120539-39120561 CGGCTGCGCGGCGCCCGGAGGGG - Intronic
929808405 2:45168995-45169017 GGGCTGGGCTGCCCCCGGCCGGG + Intergenic
929808408 2:45169008-45169030 GAGCGGAGCTGCTCCCGGCCGGG - Intergenic
931602535 2:64019033-64019055 CCGCCGCCCGGCGCCCGGCCGGG + Exonic
932699900 2:73985208-73985230 GAGGCGCGGGGGGCCCGGCCCGG + Intergenic
933666953 2:84971521-84971543 GCCCTCCGCCGCGCCCGGCCCGG - Intronic
933753210 2:85616461-85616483 GAGGTGCGCGGGGCCGGGCCGGG + Exonic
935692649 2:105744969-105744991 GAGGCTCGCGGCGCCCGGGCCGG + Exonic
938796006 2:134718823-134718845 GAGCTCAGCGGGGCCGGGCCGGG + Exonic
939629396 2:144515903-144515925 GAGCTGCGCGGCGCGGGGAGGGG - Intronic
939846634 2:147254797-147254819 GAGCCGCACCGCGCCTGGCCTGG - Intergenic
941929928 2:170929297-170929319 GAGCAGCGCGGAGCCCGGCTCGG + Exonic
942447625 2:176088497-176088519 GAACTGCGCGCCGCCGGGCCGGG + Intergenic
944221750 2:197310514-197310536 GGGCGGCGCGGAGCCCGGCGGGG - Intronic
944811186 2:203328669-203328691 GAGGCGCGCGGCCCCCGGCGGGG - Intronic
947399027 2:229714268-229714290 GGGCTGCGCGGCGCACGGCCCGG + Exonic
948140604 2:235669918-235669940 GGGCGGCGCGGCGCACGGGCCGG + Intronic
948177949 2:235959028-235959050 GAGCTGCGCGGCGCTGAGCCGGG - Intronic
948206179 2:236163900-236163922 GCGCTGGGCGGGGCGCGGCCAGG + Intergenic
948801615 2:240435848-240435870 GAACTGCGCAGGACCCGGCCAGG + Exonic
948824664 2:240568436-240568458 GAGCGGGGCGGCGCACGGCGCGG + Intronic
948991737 2:241559086-241559108 GAGGTGGGCGGCCCCGGGCCGGG + Intronic
1169383250 20:5126971-5126993 GAGCCGCGCGCCTCCCGGGCGGG + Exonic
1171977662 20:31605757-31605779 GTGCTGAGCGGAGCCCGGACCGG - Exonic
1173322385 20:41999406-41999428 CAGGTGCGCGGGGCCGGGCCGGG + Intergenic
1173494280 20:43507681-43507703 CAGGCGCGCGGCGCCCGGCTCGG + Exonic
1174467979 20:50731850-50731872 AAGGTGCGCGGGGCCCGGGCTGG + Exonic
1175399811 20:58693616-58693638 GAGCTGCGCAGTGCCCTTCCAGG + Intronic
1175894879 20:62331574-62331596 GAGCTGGGCCTGGCCCGGCCTGG - Intronic
1176019301 20:62954368-62954390 GAACTGTGCGGGGCCGGGCCAGG - Intronic
1176162059 20:63653120-63653142 GGGCTGCGAGGCGCCGCGCCGGG - Intronic
1176294017 21:5061008-5061030 GAGCTGCAAGACGCCCAGCCTGG - Intergenic
1178485871 21:33020004-33020026 GGGCTGCGCAGCGCGCGCCCGGG - Intergenic
1179863242 21:44202640-44202662 GAGCTGCAAGACGCCCAGCCTGG + Intergenic
1180071292 21:45436933-45436955 GGGCTGCGCGGGGCCCTGGCTGG + Intronic
1180921601 22:19524304-19524326 GTGCTGCGCGGCGCCCTGGGCGG + Exonic
1181902718 22:26169467-26169489 GAGCTGCGCCGGGCGCGGGCGGG - Intronic
1182429027 22:30289442-30289464 GTGCTGAGCGTCGCCCGTCCCGG - Exonic
1183411725 22:37658889-37658911 CAGCTCCGGGGCGCCCGGCACGG - Exonic
1183437619 22:37804737-37804759 GAGCTGGGCGACTCCCAGCCGGG - Intergenic
1184201717 22:42974102-42974124 GAGCTGCCAGGCACCAGGCCAGG - Intronic
1184276474 22:43411937-43411959 GAGCCTCGCGGCGCGCGGGCGGG + Intronic
1184671354 22:46013698-46013720 GAGCTGCGCTGAGCAGGGCCGGG - Intergenic
1184775332 22:46620305-46620327 GCTCAGGGCGGCGCCCGGCCAGG - Intronic
1185245670 22:49771581-49771603 GGGCTTCGCGGAGCCGGGCCTGG - Intergenic
1185315451 22:50177016-50177038 GAGCTGCGGGACGCGCTGCCCGG + Exonic
950266348 3:11575928-11575950 CAGCAGCGCGGAGCCCGTCCAGG + Intronic
951320496 3:21238615-21238637 GAGCTGTGCAGCTCCCTGCCTGG - Intergenic
954632860 3:52056470-52056492 GAGCTGCGCGCCCGCCGCCCCGG + Exonic
955320691 3:57972243-57972265 GAGGTGCTCGGCTCCTGGCCTGG - Intergenic
959085749 3:101849442-101849464 GACCTCCCCGGCGCCCGGCCCGG - Intronic
962654038 3:137524396-137524418 CAGCTGCGCGCCACCAGGCCTGG - Intergenic
966594521 3:181713257-181713279 GAGCGGCCCGGTGCCCGGCACGG + Exonic
966911402 3:184562191-184562213 GAGCCGGGCCGCGCCGGGCCGGG - Exonic
967694510 3:192515209-192515231 GGGCTGCGCGGCTTCCAGCCCGG + Intronic
967849502 3:194071218-194071240 CAGCTGCCCCGCGCCCGCCCGGG - Intergenic
968094851 3:195921661-195921683 GAGGTGGGTGGCGCCCGGCAGGG - Intergenic
968701376 4:2059648-2059670 GGGGGGCGCGGCGGCCGGCCCGG - Exonic
968701492 4:2060013-2060035 GCCCTGCGCGGGGCCCGGCGCGG - Intronic
968965061 4:3765669-3765691 GGGCCGAGCGGCGGCCGGCCTGG - Intergenic
969379107 4:6782805-6782827 GGGCGGCGCGGCGGCCGGCGGGG - Exonic
969703713 4:8781135-8781157 GAGCTGCGGGACCCCCGGTCTGG + Intergenic
971230892 4:24799727-24799749 GGGCTGCGCGGCGTCCAGCGTGG - Exonic
973279332 4:48342151-48342173 GAGCTGGGCGGGGACGGGCCCGG + Intronic
974716139 4:65670372-65670394 GAGCTGCGCTGCGGCGGCCCAGG + Intronic
975118621 4:70705354-70705376 GAGCTCCGCGGGGGCCGGGCCGG - Intronic
975166885 4:71187256-71187278 GCGCTGCCCGGCGCGCCGCCGGG - Intergenic
980960185 4:139467262-139467284 GAGGTGCGCGGCGGAAGGCCAGG - Intronic
983923476 4:173371358-173371380 CAGTTGCCCGGGGCCCGGCCCGG - Exonic
985452218 4:190068423-190068445 GTGCAGCGCGGCCCCCGGCGGGG + Intergenic
985453202 4:190071720-190071742 GTGCAGCGCGGCCCCCGGCGGGG + Exonic
985454192 4:190075013-190075035 GTGCAGCGCGGCCCCCGGCGGGG + Exonic
985455180 4:190078306-190078328 GTGCAGCGCGGCCCCCGGCGGGG + Exonic
985456168 4:190081606-190081628 GTGCAGCGCGGCCCCCGGCGGGG + Exonic
985457152 4:190084900-190084922 GTGCAGCGCGGCCCCCGGCGGGG + Intergenic
985458139 4:190088193-190088215 GTGCAGCGCGGCCCCCGGCGGGG + Exonic
985459128 4:190091493-190091515 GTGCAGCGCGGCCCCCGGCGGGG + Exonic
985463381 4:190174262-190174284 GTGCAGCGCGGCCCCCGGCGGGG + Exonic
985549015 5:523995-524017 GAGCCGCGCGGCGGCCGCCCGGG - Intronic
985562904 5:600905-600927 GAGCTGGGCAGAGCCGGGCCTGG - Intergenic
985791637 5:1931302-1931324 CAGCAGCGCGGCGTCCGGCAGGG - Intergenic
985861701 5:2476625-2476647 GAGTTGGGCGGAGCCCAGCCTGG + Intergenic
988470308 5:31531740-31531762 GAGCCGGGCGGCCCCAGGCCTGG + Intronic
988482085 5:31639356-31639378 CAGCTGCGCGGGGACCCGCCGGG + Intergenic
992042360 5:72848514-72848536 GAGCTGCGCGGGTGGCGGCCAGG - Intronic
992089358 5:73303649-73303671 GAGATGCGCGGCGTCCGCGCGGG + Intergenic
992249990 5:74866620-74866642 GAGCTGGGCGTCGCGCTGCCGGG - Intronic
994180737 5:96763261-96763283 GAGCTGCCCGGGGCCAGGTCTGG - Intronic
995224751 5:109689951-109689973 TAGCTGCGCGGCCCCGGCCCGGG + Exonic
996698374 5:126423449-126423471 GAGCTTGGCGCGGCCCGGCCTGG + Intronic
998228863 5:140346606-140346628 GCGCTGCCCGGCTCGCGGCCGGG + Exonic
998407941 5:141884428-141884450 GAGCTGCGCGCCTCCACGCCTGG + Intergenic
1002405007 5:179023873-179023895 GAGCTGCGCGCCCCCCGCCGAGG + Exonic
1002568466 5:180127325-180127347 GAGCAGCGCGGCCCACGGCCTGG + Intronic
1003545013 6:7051855-7051877 GCGCCGCGCAGCCCCCGGCCCGG + Intergenic
1007390299 6:41546690-41546712 GAGGCGCGCGGCGGTCGGCCCGG + Exonic
1007479858 6:42142663-42142685 GAGCTGGGCGGCGGCGGGGCGGG - Intergenic
1008034906 6:46735316-46735338 GAGCTGCTCGGCCCGCAGCCAGG - Exonic
1008959065 6:57247136-57247158 GAGCCACACCGCGCCCGGCCTGG + Intergenic
1011517018 6:88166165-88166187 GAGCAGCGGGGCGCCAGTCCCGG - Exonic
1013459071 6:110358157-110358179 GAGCTGCGGCGCGCCGGGCCCGG - Exonic
1015094807 6:129402434-129402456 GAGCTGCGTGGCTCTCAGCCTGG - Exonic
1019342986 7:517301-517323 CTCCTGCGCGGCGCCCCGCCCGG + Intronic
1019343601 7:519564-519586 GGGCCGCGCTGTGCCCGGCCGGG - Intronic
1019508187 7:1403901-1403923 GAGCCGGGTGGCGCCTGGCCCGG + Intergenic
1019989597 7:4682424-4682446 GGGCTGCGCGGGGGCCGGCGGGG - Exonic
1022286375 7:28958447-28958469 GAGCTTCGCGGGGCGCGGCTTGG + Intergenic
1022410350 7:30135049-30135071 GGGCAGCGCGGCGCTCGGCTCGG - Exonic
1022989619 7:35694904-35694926 CTGCTGCGCGGCGACCGGCACGG + Exonic
1026765018 7:73154959-73154981 GCGGCGCGCGGCGCCCGGCGCGG - Intergenic
1027041490 7:74964714-74964736 GCGGCGCGCGGCGCCCGGCGCGG - Intergenic
1027082152 7:75237655-75237677 GCGGCGCGCGGCGCCCGGCGCGG + Intergenic
1027224460 7:76235178-76235200 GAGCTGCGCGCCGCGGAGCCGGG + Exonic
1029483825 7:100827524-100827546 GGGCCGGGCGGCGCCGGGCCCGG + Intronic
1029581567 7:101439836-101439858 GAGCTGTGTGGCACCTGGCCGGG + Intronic
1031317285 7:120273402-120273424 GGGCTGCGGGGCGGCCGGGCGGG - Intergenic
1031997247 7:128240931-128240953 GAGCCGCGCGGGGCGCGGTCGGG - Intergenic
1034978282 7:155460320-155460342 GAGCTGGGCCGGGCCAGGCCGGG - Intronic
1035160922 7:156949601-156949623 GAGCTGCGCGGAGCCGGGTGCGG - Intergenic
1035266104 7:157691014-157691036 GAGCCGCGCCGCCGCCGGCCGGG - Intronic
1035580764 8:738031-738053 GGGATGCGCGGAGCCCGGCGAGG - Intronic
1036032671 8:4991544-4991566 CAGCTGCGCCGCGCGCGCCCGGG - Intronic
1036398129 8:8386124-8386146 GTGCAGGGAGGCGCCCGGCCGGG - Intronic
1037903836 8:22703782-22703804 GAGCGGCGCCGCCCGCGGCCCGG - Intergenic
1038554017 8:28494189-28494211 GAGCACCGGGGCGCGCGGCCCGG - Exonic
1038644378 8:29350494-29350516 GCTCTGCGCGCCGCCCGGCTGGG - Exonic
1038808008 8:30812497-30812519 GAGGGGAGCGGCGCCCGGGCCGG - Exonic
1040599524 8:48870241-48870263 GAGCCCCGCGCCTCCCGGCCGGG - Intergenic
1041248456 8:55911676-55911698 GAGCTGCGGGGCACCTGCCCTGG + Intronic
1042611696 8:70607882-70607904 CAGCTCCCCGGCGGCCGGCCCGG - Intronic
1043388280 8:79768402-79768424 GGGCTGGGCGGCCGCCGGCCGGG + Intergenic
1047732088 8:127736308-127736330 GAGCTGCGCTGCGGGCGTCCTGG + Exonic
1049660025 8:143815734-143815756 GGGCTGCGCGGCGGCCGGGTGGG - Intergenic
1051170652 9:14315599-14315621 GAGCCGCTCGGCGCCCGCGCCGG + Intronic
1052837778 9:33264577-33264599 GACTGGCGCGGCTCCCGGCCTGG + Exonic
1052946439 9:34172164-34172186 GAGGTGCGCGCCACCAGGCCTGG + Intergenic
1052991834 9:34523082-34523104 GAGCTGCGCGGTGTTCGGCTGGG + Intergenic
1053129120 9:35605418-35605440 GAGCGGCGCGGCGTCCACCCGGG + Exonic
1053239960 9:36487450-36487472 AAGCTCGGCGGGGCCCGGCCTGG + Intronic
1057259681 9:93576694-93576716 GCGCGGCCCGGCCCCCGGCCCGG + Exonic
1057773020 9:97984027-97984049 GGGGCGCGCGGAGCCCGGCCTGG - Intronic
1060555053 9:124503787-124503809 GAGCGCTGGGGCGCCCGGCCCGG + Intronic
1060974171 9:127754968-127754990 CAGCTCAGCGGCGCCCGGCAGGG - Intronic
1061057953 9:128234110-128234132 GAGCCCCGCAGCACCCGGCCTGG + Intronic
1061130584 9:128705752-128705774 GAGCTGCTCTGCCCACGGCCGGG - Exonic
1061225057 9:129276636-129276658 GAGGTGCACGGGGCCCGGGCAGG - Intergenic
1061503899 9:131019884-131019906 GGGCGGTGCGGGGCCCGGCCGGG - Intronic
1061851282 9:133417580-133417602 GAGCTGCGCAGCGCTCCGCCCGG + Intronic
1061961832 9:133992556-133992578 TGGCTGCGTGGAGCCCGGCCCGG - Intronic
1062049725 9:134441033-134441055 GGGCTGGGCTGCTCCCGGCCTGG + Intergenic
1062320859 9:135989991-135990013 GAGCAGCCCGGTGCCAGGCCAGG + Intergenic
1062529618 9:136994173-136994195 GAGCTGAGAGGGGCCCAGCCAGG + Intergenic
1062544245 9:137054469-137054491 GAGCCACGCGGGGCCCGGGCTGG + Intergenic
1062574604 9:137200358-137200380 GATCTGCGCGGCCCCCGGGGCGG + Exonic
1185471442 X:386440-386462 GGGCAGCGCAGGGCCCGGCCCGG + Exonic
1187900790 X:24025426-24025448 GAGCCGCCCGGGGCCCGCCCAGG + Intronic
1189324559 X:40104970-40104992 GGGCTCCGCGGAGCCCGGCCAGG + Intronic
1195269409 X:103215384-103215406 GAGCGGAGAGGTGCCCGGCCCGG + Intronic
1195342432 X:103918753-103918775 GGACTGGGCGGCGCCCGGCTTGG - Intergenic
1195364385 X:104112858-104112880 GGACTGGGCGGCGCCCGGCTTGG + Exonic
1196645750 X:118116425-118116447 GCGCTGCGCGGTGCGCGGCGAGG - Intronic
1198682228 X:139194993-139195015 GAGCTGCCCGGCGCCGGCTCCGG - Intronic
1198750291 X:139932143-139932165 GAGCAGCGAGGCGGGCGGCCGGG + Intronic
1199649264 X:149937885-149937907 GAGCTATGCACCGCCCGGCCTGG + Intronic
1199699178 X:150363721-150363743 GAGCTGCGCCCAGCCCAGCCGGG - Intronic
1201240625 Y:11954191-11954213 GAGCTGCCTCGCTCCCGGCCCGG + Intergenic