ID: 1094564938

View in Genome Browser
Species Human (GRCh38)
Location 12:31590855-31590877
Sequence TTCCCGGGCGGCGGCGGCGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1593
Summary {0: 1, 1: 6, 2: 67, 3: 303, 4: 1216}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094564938_1094564948 10 Left 1094564938 12:31590855-31590877 CCGCCGCCGCCGCCGCCCGGGAA 0: 1
1: 6
2: 67
3: 303
4: 1216
Right 1094564948 12:31590888-31590910 GGAGGCTGCCACCACCGCTCCGG 0: 1
1: 0
2: 4
3: 15
4: 194
1094564938_1094564946 -8 Left 1094564938 12:31590855-31590877 CCGCCGCCGCCGCCGCCCGGGAA 0: 1
1: 6
2: 67
3: 303
4: 1216
Right 1094564946 12:31590870-31590892 CCCGGGAAGGCTTTCTGCGGAGG 0: 1
1: 0
2: 1
3: 19
4: 124
1094564938_1094564949 16 Left 1094564938 12:31590855-31590877 CCGCCGCCGCCGCCGCCCGGGAA 0: 1
1: 6
2: 67
3: 303
4: 1216
Right 1094564949 12:31590894-31590916 TGCCACCACCGCTCCGGCTGTGG 0: 1
1: 1
2: 0
3: 15
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094564938 Original CRISPR TTCCCGGGCGGCGGCGGCGG CGG (reversed) Exonic
900092020 1:924721-924743 ATCCGGGGCCGCGGCCGCGGTGG - Intergenic
900113608 1:1019771-1019793 CTTCCGGGGGGCCGCGGCGGGGG + Intergenic
900349668 1:2228497-2228519 GGCCCGGGCGGCGGCGGGCGCGG + Intergenic
900414671 1:2529502-2529524 GTGCGCGGCGGCGGCGGCGGCGG + Exonic
900512970 1:3069045-3069067 ATCCCGCGCCGAGGCGGCGGCGG + Intergenic
900512974 1:3069051-3069073 CGCCGAGGCGGCGGCGGCGGCGG + Intergenic
901056028 1:6448974-6448996 GGCAGGGGCGGCGGCGGCGGTGG - Exonic
901060961 1:6471724-6471746 TTCGGGGGCGGCGGCGGGTGAGG - Intronic
901086288 1:6614043-6614065 TTCCGGGCGGGGGGCGGCGGCGG - Exonic
901109834 1:6785642-6785664 ATCCCGGGCATCGGCGGCGCCGG + Intronic
901459473 1:9383140-9383162 TTCCCGGGAGGCGGGGACTGTGG - Intergenic
901629008 1:10639206-10639228 CTCCCCAGCTGCGGCGGCGGCGG + Exonic
901633064 1:10657256-10657278 GTTCCTGGCGGTGGCGGCGGCGG - Intronic
901641344 1:10694606-10694628 GCACCGGGCGGCGGCGGCGGCGG - Intronic
901800691 1:11706426-11706448 TGCCCGGGCCCCGCCGGCGGTGG - Exonic
902323650 1:15684505-15684527 CGGCGGGGCGGCGGCGGCGGTGG + Exonic
902350110 1:15847965-15847987 TGCCGGGGCGGCGGCGGCGGCGG - Exonic
902366206 1:15975920-15975942 AGCCGGGGCGGAGGCGGCGGAGG - Intronic
902478330 1:16699521-16699543 GGCAGGGGCGGCGGCGGCGGCGG + Intergenic
902600893 1:17539700-17539722 GTCGCGCACGGCGGCGGCGGCGG + Intergenic
902690586 1:18108104-18108126 TGCCCGGGAGCTGGCGGCGGTGG - Exonic
902823238 1:18956232-18956254 GGCGGGGGCGGCGGCGGCGGCGG - Exonic
902823242 1:18956238-18956260 TGCCCTGGCGGGGGCGGCGGCGG - Exonic
902823251 1:18956262-18956284 CCGCCGGGCGGCGGCGGCGGGGG - Exonic
902823256 1:18956265-18956287 TGCCCGCCGGGCGGCGGCGGCGG - Exonic
902896892 1:19485433-19485455 TACCATGGTGGCGGCGGCGGCGG + Exonic
903044291 1:20553889-20553911 TGCGCGGGCGGCGGGGGCGCCGG - Exonic
903115533 1:21176305-21176327 CACCGGAGCGGCGGCGGCGGCGG - Exonic
903263422 1:22143122-22143144 TGCGGCGGCGGCGGCGGCGGCGG + Intronic
903324740 1:22563449-22563471 GCCCGGGGCGGCGGCGGCGGCGG + Intergenic
903475997 1:23619576-23619598 TGCTGTGGCGGCGGCGGCGGCGG - Intronic
903498901 1:23791252-23791274 TACCCAGCCGGCGGCTGCGGAGG + Intronic
903501085 1:23800546-23800568 TGCCCGGGCTGGGGCGGCCGGGG - Intronic
903514805 1:23903074-23903096 TTCATGGGCGGCGGCGGCGGCGG + Intronic
903526622 1:23995652-23995674 TTCTCGGGGCGCGGGGGCGGGGG + Intergenic
903652327 1:24929789-24929811 TTCCCCTGCGGCGGCGGCGGCGG - Exonic
903750210 1:25616797-25616819 AGCCCGAGCGGCGGCGGCGGCGG + Intergenic
903777142 1:25800352-25800374 GACCCGGACGGCGGCGGCAGCGG - Exonic
903828643 1:26161949-26161971 AGCCCGGGCGGCGCGGGCGGCGG + Exonic
903829118 1:26164412-26164434 CTCGCAGGCGGCGGCGGCGGCGG - Intergenic
903875861 1:26472673-26472695 CACCAGGGAGGCGGCGGCGGCGG - Intronic
903907302 1:26696204-26696226 CTCCGGGCTGGCGGCGGCGGAGG - Exonic
903907390 1:26696449-26696471 TCCGAGGGCGGCGGCGGCGGCGG - Exonic
903907538 1:26696953-26696975 CTGCAGAGCGGCGGCGGCGGGGG + Exonic
903967580 1:27100129-27100151 TTCCCGGGAGGCGGCAGGGGAGG + Exonic
903998317 1:27322237-27322259 ATCCTGGGCGGGGGTGGCGGCGG - Exonic
904500201 1:30908786-30908808 CGGCCCGGCGGCGGCGGCGGCGG - Intergenic
904542099 1:31239951-31239973 CTCCCTGTCGGTGGCGGCGGCGG - Intergenic
904641987 1:31938057-31938079 CACCTCGGCGGCGGCGGCGGCGG + Exonic
904641989 1:31938060-31938082 CTCGGCGGCGGCGGCGGCGGCGG + Exonic
904642014 1:31938140-31938162 CGGCCCGGCGGCGGCGGCGGCGG + Exonic
904676180 1:32200639-32200661 TTCCCGGGAGGAGAGGGCGGAGG + Exonic
904719958 1:32500485-32500507 GTAGCGGGCGGCGGCGGCGGCGG + Intronic
904720061 1:32500824-32500846 CCTCCTGGCGGCGGCGGCGGCGG + Intronic
904762700 1:32817303-32817325 TTCCCGGCACGCGGCGGCGACGG - Exonic
904769066 1:32870911-32870933 CTCCCGCGCGGCGGCGGTGGCGG + Intronic
904822727 1:33256161-33256183 TTGCCAGGCGGTGGCGGCGGCGG + Intergenic
904822830 1:33256457-33256479 CGCCGAGGCGGCGGCGGCGGCGG - Intergenic
904822949 1:33256820-33256842 GCCCAGAGCGGCGGCGGCGGCGG + Intronic
905137120 1:35808335-35808357 TTACGCGGCGGCGGCGGCGGCGG + Exonic
905179265 1:36156366-36156388 CTCAGCGGCGGCGGCGGCGGCGG - Exonic
905212674 1:36385538-36385560 TTCCCCGGCGGCAGGGGCGAGGG - Intronic
905212704 1:36385643-36385665 GGCCCCGGCGGCCGCGGCGGTGG - Intronic
905414383 1:37794390-37794412 GTGCGGGGCGGCGGCGGCGGCGG - Exonic
905449114 1:38046031-38046053 CACCCGGGCGCGGGCGGCGGCGG - Exonic
905449166 1:38046232-38046254 TACCCGGGGGGCGGCGGCGGCGG - Exonic
905449286 1:38046644-38046666 CGCCGCGGCGGCGGCGGCGGCGG - Exonic
905580802 1:39081728-39081750 CTCCCCGGCGCCGGCCGCGGGGG - Intronic
905862643 1:41361507-41361529 TCACCGGGCGGCGGCGGCGCGGG + Intergenic
905947772 1:41918117-41918139 ATCACAGGCGGCGGCGGCGGCGG - Intronic
906204393 1:43979333-43979355 GCCCGCGGCGGCGGCGGCGGCGG + Intronic
906319724 1:44808536-44808558 CTGGCTGGCGGCGGCGGCGGCGG - Exonic
906397991 1:45483670-45483692 TTGCCGCGAGGGGGCGGCGGAGG + Intronic
906520970 1:46466709-46466731 ATCGCGCGCGGCGGCGACGGCGG + Intergenic
906637013 1:47416488-47416510 GCCCGGGGCGGCGGCGGCGGCGG + Exonic
906640676 1:47438867-47438889 TGGCGGGGCCGCGGCGGCGGGGG + Exonic
906960918 1:50419097-50419119 CCCCCCGGCGGCGGCGGCGGCGG + Exonic
907010631 1:50959893-50959915 GCGCCCGGCGGCGGCGGCGGCGG - Exonic
907053507 1:51345078-51345100 GCCCCTCGCGGCGGCGGCGGCGG + Exonic
907767295 1:57423955-57423977 TTCCTGGGCGGCTGCGGCAGCGG - Exonic
908401132 1:63774055-63774077 TCCCTCGGCGGCGGCGGTGGCGG - Exonic
908527580 1:65002683-65002705 AGCCTGGCCGGCGGCGGCGGAGG + Intergenic
909475205 1:76074602-76074624 GTCCTGGGCGCCGGCGCCGGCGG - Intergenic
909622500 1:77683477-77683499 CTGGCGGGCGGCGGCGGCGGCGG + Intergenic
910277556 1:85465058-85465080 CTTAGGGGCGGCGGCGGCGGCGG + Exonic
910448993 1:87328532-87328554 CTCGGAGGCGGCGGCGGCGGCGG - Exonic
910758862 1:90716816-90716838 TGCTGGGGGGGCGGCGGCGGCGG + Exonic
910759004 1:90717600-90717622 GACCCCGGCAGCGGCGGCGGCGG - Intergenic
912174681 1:107141227-107141249 TCCCCGGGCTGCGGCGGTGGCGG + Intronic
912246277 1:107964921-107964943 AACCGCGGCGGCGGCGGCGGCGG - Exonic
913565563 1:120069430-120069452 TGCCCAGGCGGCGGCGGCGGCGG - Exonic
913615718 1:120558169-120558191 TCCCGAGGCGGCGGCGGCGGCGG + Intergenic
913632567 1:120724123-120724145 TGCCCAGGCGGCGGCGGCGGCGG + Intergenic
913670970 1:121097297-121097319 TCCCCGGGCGCTGGCGGCTGCGG - Intergenic
913941705 1:125115650-125115672 TTCCTGGGCGGCGGTGGTTGAGG - Intergenic
914022733 1:143884718-143884740 TCCCCGGGCGCTGGCGGCTGCGG - Intergenic
914237315 1:145823880-145823902 CTCTCGGACGGCCGCGGCGGAGG - Exonic
914286156 1:146228796-146228818 GGCCGCGGCGGCGGCGGCGGAGG - Exonic
914286161 1:146228805-146228827 TGCCCAGGCGGCCGCGGCGGCGG - Exonic
914428604 1:147600198-147600220 CCCCCCGGCGGCGGCAGCGGCGG - Intronic
914547188 1:148679549-148679571 TGCCCAGGCGGCGGCGGCGGAGG - Intronic
914574558 1:148952733-148952755 TCCCGAGGCGGCGGCGGCGGCGG - Intronic
914619315 1:149390797-149390819 TGCCCAGGCGGCGGCGGCGGCGG + Intergenic
914661220 1:149792662-149792684 TCCCCGGGCGCTGGCGGCTGCGG - Intronic
914730393 1:150364665-150364687 TCCTCTGGCGGCGGCGGCGGCGG - Intronic
914730408 1:150364715-150364737 ATGGCGGCCGGCGGCGGCGGAGG + Exonic
914852801 1:151327376-151327398 TTCCCTGACAGCGGCCGCGGAGG + Exonic
915070332 1:153261124-153261146 TACTCTGGCGGCGGCTGCGGCGG + Exonic
915070345 1:153261151-153261173 TCCTCCGGCGGCGGGGGCGGGGG + Exonic
915070445 1:153261478-153261500 TTCTCCAGCGGCGGGGGCGGCGG + Exonic
915070488 1:153261670-153261692 TTCTCCAGCGGCGGGGGCGGCGG + Exonic
915070516 1:153261775-153261797 TCCTCTGGAGGCGGCGGCGGCGG + Exonic
915142383 1:153775652-153775674 TTCCGGGTCGGCGGCAGCCGCGG - Exonic
915246349 1:154558630-154558652 GACCGCGGCGGCGGCGGCGGCGG - Exonic
915325321 1:155078911-155078933 TCGGGGGGCGGCGGCGGCGGCGG + Exonic
916065506 1:161132643-161132665 GGCCGCGGCGGCGGCGGCGGCGG - Exonic
916588325 1:166166713-166166735 TGCAGCGGCGGCGGCGGCGGCGG - Exonic
916651667 1:166839612-166839634 CGCGCGGGCGGGGGCGGCGGCGG + Intronic
916785698 1:168085619-168085641 GTCCCGGGGGGCGGCTTCGGGGG - Exonic
916922680 1:169485721-169485743 TCGGCGGGCGGCGGCGGCGGCGG - Exonic
916922681 1:169485724-169485746 GTCTCGGCGGGCGGCGGCGGCGG - Exonic
917141568 1:171841140-171841162 TGCCCCGGTGGTGGCGGCGGCGG + Intergenic
917817435 1:178725252-178725274 CCCCCGAGCGGCAGCGGCGGCGG + Exonic
917846691 1:179026016-179026038 CTCCCCGGAGGCGGCGGGGGCGG + Exonic
918064270 1:181089101-181089123 TCCCCGGGCTGCTGCTGCGGTGG - Exonic
919925034 1:202187761-202187783 TTCCCGGGCTGGGGCTGCTGGGG + Intergenic
919926347 1:202193844-202193866 TTGGGCGGCGGCGGCGGCGGTGG - Intergenic
919926348 1:202193847-202193869 CTATTGGGCGGCGGCGGCGGCGG - Intergenic
920705007 1:208244296-208244318 TCCCGCGGTGGCGGCGGCGGCGG + Exonic
921060229 1:211578899-211578921 CACCCAGGCGGCGGCGGTGGCGG + Intergenic
921414473 1:214870541-214870563 TGGTCGGGCGGCGGCGGCTGCGG + Intergenic
921603982 1:217135521-217135543 CGCGCGCGCGGCGGCGGCGGCGG + Intronic
921947570 1:220896553-220896575 TACCAGGGCGGGGGCGGAGGTGG + Intergenic
923141457 1:231163732-231163754 TCGGCGGGCGGCGGCGGCGGCGG - Exonic
923171551 1:231421883-231421905 GGCCATGGCGGCGGCGGCGGCGG + Exonic
923400778 1:233614076-233614098 GGCCCGGGCGGGGGCGGGGGCGG + Exonic
924289721 1:242524713-242524735 TCCCGGGGCGGCGGCGGCGGCGG + Intergenic
924415064 1:243850041-243850063 TGCAACGGCGGCGGCGGCGGTGG + Intronic
924561074 1:245156546-245156568 TCCCCGGGCTCCGGCAGCGGCGG + Exonic
924754788 1:246931494-246931516 ACCCGCGGCGGCGGCGGCGGCGG - Intronic
1063824605 10:9880068-9880090 AACCCGGGAGGCGGAGGCGGAGG - Intergenic
1064179189 10:13100183-13100205 CTGCCGGCGGGCGGCGGCGGTGG - Exonic
1064208929 10:13347666-13347688 TTTTTGCGCGGCGGCGGCGGCGG - Intronic
1064208969 10:13347774-13347796 GCCCCGCGCGGCGGCGGCGGCGG + Intronic
1064209075 10:13348108-13348130 GCGCCCGGCGGCGGCGGCGGCGG + Exonic
1064443171 10:15371240-15371262 AGCCGCGGCGGCGGCGGCGGCGG + Intergenic
1064443184 10:15371311-15371333 GGCGCGGGCAGCGGCGGCGGCGG - Intergenic
1064619589 10:17201642-17201664 CTCCGGGGCTGCGGCGGCTGAGG - Exonic
1064712433 10:18140766-18140788 TCCCACAGCGGCGGCGGCGGTGG + Exonic
1064981869 10:21173841-21173863 GTTCCCGGGGGCGGCGGCGGCGG + Intronic
1064981871 10:21173844-21173866 CCCGGGGGCGGCGGCGGCGGCGG + Intronic
1064982011 10:21174345-21174367 TCCCCGGCCTGCAGCGGCGGTGG - Intergenic
1065023094 10:21516901-21516923 AGCCAAGGCGGCGGCGGCGGCGG - Exonic
1065520572 10:26567288-26567310 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1065526082 10:26622526-26622548 CTCCCGGGAGGCGGCGGGGCAGG - Intergenic
1065589783 10:27252572-27252594 GCCCCTGGCGGCGGCGGCGGGGG - Intergenic
1065687634 10:28302574-28302596 ACTCCGGGCGGGGGCGGCGGCGG - Intronic
1065712825 10:28533495-28533517 CGCGCAGGCGGCGGCGGCGGCGG - Exonic
1065925844 10:30433661-30433683 CTCCCGGGGGGCGGCGGGGAGGG - Intergenic
1066023085 10:31320860-31320882 TACCGGGGCGGCGCAGGCGGGGG - Intronic
1066094048 10:32056105-32056127 TCCCCGGGTGGAGGCGGCCGGGG + Exonic
1066429272 10:35336656-35336678 TTCCCCGGCGGCTGCGGCGACGG - Intronic
1066429330 10:35336850-35336872 GCCATGGGCGGCGGCGGCGGCGG - Intronic
1066464218 10:35639481-35639503 GGGCCGGGGGGCGGCGGCGGCGG - Exonic
1066464803 10:35641989-35642011 AACTCCGGCGGCGGCGGCGGCGG - Exonic
1066963450 10:42241797-42241819 TTCCCGGGGGGGGGGGGGGGGGG - Intergenic
1067091333 10:43267009-43267031 CTCCCCGGCGCCGGCTGCGGAGG - Intergenic
1067972722 10:50991327-50991349 TTCTCGGGCGGCGGCGGCGGCGG - Intergenic
1068690165 10:59906315-59906337 ACCTCGGGCGGCGGCGGTGGCGG - Exonic
1069019185 10:63466134-63466156 TCCAGAGGCGGCGGCGGCGGCGG + Intergenic
1069495681 10:68901356-68901378 TGCCCGGAGGGAGGCGGCGGTGG + Exonic
1070032616 10:72692194-72692216 TCTCGGGGCGGCGGCGGCGGGGG + Exonic
1070112033 10:73495822-73495844 GCCCCGGGAGGGGGCGGCGGGGG + Exonic
1070257920 10:74826667-74826689 ACCCCTGGCGGCGGCGGCAGCGG + Exonic
1070570644 10:77637742-77637764 CTCCGCGGCGGCGGCGGCGGCGG - Intronic
1070800781 10:79243343-79243365 CTCCTCGGCGGCGGCGGCGGCGG + Intronic
1070800805 10:79243450-79243472 TAGCCGGACGGCGGCGGCGGTGG + Intronic
1070800863 10:79243666-79243688 GGCCCGGCCGGCGGCGGCCGCGG - Intronic
1070877386 10:79826378-79826400 CGGCGGGGCGGCGGCGGCGGCGG + Intergenic
1071086643 10:81874599-81874621 CTCTCCGGCGGCGGCGGCAGCGG + Intergenic
1071086896 10:81875449-81875471 GGCCCGGACGGCGGCGGCGAAGG + Exonic
1071695293 10:87863515-87863537 TCCCGGCGCGGCGGCGGAGGGGG + Exonic
1071835735 10:89415232-89415254 TTTCCCGGAGGCGGCGGCCGCGG - Intronic
1072263244 10:93702532-93702554 GTTGCGGGCGGCGGCGGCGGCGG - Exonic
1072710813 10:97714528-97714550 TTCCCGGGCGCGGGCGACAGTGG - Exonic
1072719462 10:97771812-97771834 CATGCGGGCGGCGGCGGCGGGGG - Exonic
1072719502 10:97771934-97771956 CTCCGCGGCGGCGGCGGCGGCGG - Exonic
1072915522 10:99535450-99535472 TGCGGCGGCGGCGGCGGCGGCGG - Exonic
1072915523 10:99535453-99535475 TGCTGCGGCGGCGGCGGCGGCGG - Exonic
1072915539 10:99535509-99535531 TACCCGGCGGGCGGCGGCGGCGG + Exonic
1072915542 10:99535512-99535534 CCGGCGGGCGGCGGCGGCGGCGG + Exonic
1073196438 10:101695147-101695169 TCCCGGGGCGGCGGCGGTGGCGG - Exonic
1073812289 10:107164423-107164445 GCCCCGGGCGTCTGCGGCGGCGG - Exonic
1074182580 10:111077296-111077318 CTCCGGGACGGCGGCGGCGGCGG - Exonic
1074618592 10:115093820-115093842 CCGGCGGGCGGCGGCGGCGGGGG + Exonic
1074815714 10:117139824-117139846 GTCCCGCGGGGTGGCGGCGGAGG - Intergenic
1074843217 10:117375229-117375251 GGCCCGGGCGGAGGCGGTGGCGG - Exonic
1075438461 10:122461627-122461649 GACTCTGGCGGCGGCGGCGGTGG - Exonic
1075629315 10:123991681-123991703 GGCCGGGGCGGTGGCGGCGGCGG + Intergenic
1075693762 10:124418798-124418820 TTCCCTGACAGCGGCGGGGGAGG - Intronic
1075748428 10:124743978-124744000 GGGCCGGGCGGCGGCGGCGGTGG - Intronic
1075802147 10:125160357-125160379 CACCCTGGAGGCGGCGGCGGCGG + Intronic
1076487442 10:130833767-130833789 TTCCTCGGCGGCGGGGGAGGTGG + Intergenic
1076554145 10:131311318-131311340 GTGCGCGGCGGCGGCGGCGGCGG + Exonic
1076554207 10:131311517-131311539 ACCCAGGGCGGCGGCGGCGGCGG + Exonic
1076554276 10:131311788-131311810 TCCGGGGGCGGCGGCGGCGCGGG - Intergenic
1076638911 10:131901016-131901038 CTCCCCGGCGGCGGCGGCGGCGG + Exonic
1076722035 10:132397012-132397034 CTCCCGGGACGCGGCGGCGGCGG + Intergenic
1076722084 10:132397159-132397181 TGACCCGGCGGCGGCGGCGGCGG + Exonic
1076750084 10:132538051-132538073 GGGCTGGGCGGCGGCGGCGGCGG - Exonic
1076750094 10:132538072-132538094 TGCCCGGGCGGCGCGGGCGCTGG - Exonic
1076792538 10:132784929-132784951 AGCCCGTGCGGCGGCGGCGCGGG - Exonic
1076792880 10:132786106-132786128 CGGGCGGGCGGCGGCGGCGGCGG + Intergenic
1076859706 10:133134967-133134989 TGCCCAGGTGGCGGCGGTGGTGG + Intergenic
1076878677 10:133229843-133229865 AGCCCGGGCGGGGGCGGCGGGGG + Intergenic
1077133939 11:989247-989269 AACCCGGGAGGCGGAGGCGGAGG + Intronic
1077188610 11:1246422-1246444 TGCCCGGGTGGAGGAGGCGGTGG - Exonic
1077204935 11:1337492-1337514 TTCCCGGGGGCCCGAGGCGGGGG + Intergenic
1077214545 11:1389996-1390018 GGCCTCGGCGGCGGCGGCGGCGG + Intronic
1077214547 11:1389999-1390021 CTCGGCGGCGGCGGCGGCGGCGG + Intronic
1077385826 11:2269113-2269135 TTCCGGGGCTGAGGCTGCGGGGG + Exonic
1077836300 11:5930511-5930533 TTCCCGAGAGGAGGCGGCTGAGG + Intronic
1078057408 11:8019255-8019277 TCCGCGGGCGGCGGCGGCGCTGG - Intronic
1078091677 11:8268201-8268223 CGCCCGGGCTTCGGCGGCGGCGG - Intronic
1078699726 11:13668929-13668951 TACCCGGGCGGGGGCGGGGGCGG - Intronic
1079180411 11:18188913-18188935 TGCCCGGGCGCTGACGGCGGTGG + Exonic
1079237105 11:18698870-18698892 CACCATGGCGGCGGCGGCGGCGG - Exonic
1079353683 11:19713643-19713665 GTCCCTGGCAGCGGCGGCGGGGG - Exonic
1080012326 11:27472001-27472023 GGCCCGGGCGGCGGCGGGGCGGG + Intronic
1080503770 11:32893165-32893187 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1080606656 11:33869724-33869746 GGACCGGGCGGTGGCGGCGGCGG - Exonic
1081465391 11:43312060-43312082 TTCCGAGGCGGCGGTGGCGCCGG + Exonic
1081492581 11:43579620-43579642 GCCCCGCGCCGCGGCGGCGGCGG + Intronic
1081807901 11:45900159-45900181 TCTGCGGGCGGCGGCGGCGCGGG + Exonic
1081831884 11:46121456-46121478 TCCCCGGGCTGAGGCGGCGGAGG - Intergenic
1081832050 11:46121965-46121987 CTCCAGTGCAGCGGCGGCGGCGG + Intergenic
1081832053 11:46121971-46121993 TGCAGCGGCGGCGGCGGCGGCGG + Intergenic
1081896839 11:46593986-46594008 CTCCTGAGCGGCGGCGGCGCCGG - Intronic
1081925748 11:46826818-46826840 TACCCGGCAGGCGGCGGCGGCGG + Intronic
1082003741 11:47408644-47408666 TCACCGTGCGGCGGCGGCGGCGG - Exonic
1082928903 11:58579232-58579254 GTCCTAGGCGGCGGAGGCGGAGG - Exonic
1083171092 11:60924496-60924518 GGGGCGGGCGGCGGCGGCGGCGG + Exonic
1083430681 11:62612472-62612494 GCTCCGAGCGGCGGCGGCGGAGG + Exonic
1083595548 11:63916963-63916985 GGCACCGGCGGCGGCGGCGGCGG + Intergenic
1083617964 11:64035775-64035797 TCCCCTCGCGGCGGCGGCGGCGG - Intronic
1083623648 11:64060934-64060956 CACCGCGGCGGCGGCGGCGGCGG + Intronic
1083659843 11:64246893-64246915 AGCTCGGGCGGCGGCCGCGGGGG - Exonic
1083670842 11:64299282-64299304 TTCCCGGGGGGTCGCGGAGGGGG + Intronic
1083753667 11:64777986-64778008 GGCCCGGCCGGCGGCGGAGGAGG - Exonic
1083753753 11:64778232-64778254 CCCACGGGCGGGGGCGGCGGCGG + Exonic
1083776458 11:64896492-64896514 TTCCAGGGCGGCAGAGGCTGTGG + Exonic
1083970304 11:66070405-66070427 CCCCGCGGCGGCGGCGGCGGGGG - Intronic
1083970309 11:66070408-66070430 TTCCCCCGCGGCGGCGGCGGCGG - Intronic
1084041842 11:66546986-66547008 TTTGCGGGCGGCGGCGGGGGCGG + Intronic
1084129033 11:67119337-67119359 CTCCCCGGCAGCGGCGGCGGCGG + Intronic
1084146156 11:67266438-67266460 CGCGCGGGCGGCGGCGGCGGCGG + Exonic
1084275633 11:68049746-68049768 TCCGCAGGCGGCGGCGGTGGCGG - Exonic
1084284162 11:68120939-68120961 TCTGCGGGCGGCTGCGGCGGCGG + Exonic
1084284270 11:68121384-68121406 TCCTCGTGCGGCGGCGGCAGAGG - Intronic
1084310229 11:68312517-68312539 GGCGCGGGTGGCGGCGGCGGGGG + Intergenic
1084892612 11:72244006-72244028 GGCCCGGGGGGCGGGGGCGGGGG + Exonic
1084973035 11:72781711-72781733 CTCCCGGGCAGCTGCGGCGGCGG - Intronic
1085165816 11:74398452-74398474 GGGGCGGGCGGCGGCGGCGGCGG - Exonic
1085197929 11:74683514-74683536 TGACCGGGCGGCGGCGGCGCTGG - Intergenic
1085295663 11:75430320-75430342 GGCCGGGGCGGCGGCGGCGCTGG - Exonic
1085322548 11:75583715-75583737 TCCCCGGGCGGCTGCAGCAGGGG + Intergenic
1085423207 11:76381067-76381089 TGCACCAGCGGCGGCGGCGGCGG - Intergenic
1085485666 11:76860950-76860972 CGCCTGGGCGGCGGCGGCGGCGG + Exonic
1086064564 11:82732561-82732583 TGATGGGGCGGCGGCGGCGGGGG + Exonic
1086322339 11:85664289-85664311 TCCCCAGGAGGAGGCGGCGGTGG - Exonic
1086464299 11:87037754-87037776 TTCCCGCGCGGCGGCGCGGCTGG - Intergenic
1086887836 11:92224976-92224998 ACCCCCGGCGGCGGCGGCGGCGG + Intergenic
1087672753 11:101127550-101127572 CGCCCCGGCGGCGGCGGCAGAGG + Exonic
1089432652 11:118436558-118436580 ACCGGGGGCGGCGGCGGCGGGGG + Exonic
1089543666 11:119206285-119206307 ATAGCCGGCGGCGGCGGCGGCGG + Exonic
1089993426 11:122882896-122882918 GGCCCGGGCGGCGGCGGCGGCGG + Exonic
1090194046 11:124800078-124800100 GCCCCGGCAGGCGGCGGCGGCGG + Exonic
1090194056 11:124800112-124800134 TCCCCTGGTGGCGGCGGTGGCGG - Exonic
1090224630 11:125062828-125062850 TTCGTGGGCGGGGGCGGGGGGGG - Intergenic
1091248933 11:134125177-134125199 TGCCCGTGCAGCGGCGGTGGCGG - Intronic
1091381885 12:67136-67158 TTCCTGGGCCCTGGCGGCGGCGG - Exonic
1091450323 12:568879-568901 TACCCGGGGGGCGGGGGGGGGGG - Intronic
1091498303 12:991239-991261 TGCTGTGGCGGCGGCGGCGGCGG + Intronic
1091550290 12:1530986-1531008 AGCCGGGGCGGCGGCGGCGGCGG - Intronic
1091558584 12:1594167-1594189 GCCCGAGGCGGCGGCGGCGGCGG - Intronic
1091759457 12:3077382-3077404 TCCGCTGGCGGCGGCGGCGGCGG + Exonic
1091823165 12:3491294-3491316 CTCCGCGGCGGCGGCGGCGGCGG - Exonic
1091973928 12:4810123-4810145 TTCCCGGAGGCCGGCGGGGGCGG + Exonic
1092172829 12:6384274-6384296 GTCCTGGGCAGCGGTGGCGGCGG - Exonic
1092216771 12:6689094-6689116 TCACCGGGCGGCGACGGCTGCGG + Intronic
1092335410 12:7628708-7628730 GGCAGGGGCGGCGGCGGCGGCGG - Intergenic
1092335420 12:7628735-7628757 GGCAGGGGCGGCGGCGGCGGCGG - Intergenic
1092727683 12:11500722-11500744 TTCCTGGGCCCCGGCGGTGGCGG - Intronic
1093465069 12:19440198-19440220 AGCCAGGGCGGCGGCGGGGGCGG + Exonic
1093958795 12:25250910-25250932 TTCCTAGGCGGCGGCCGCGGCGG - Intronic
1094041123 12:26122643-26122665 TCCCGCGGCGGCGGCAGCGGCGG - Exonic
1094466037 12:30754769-30754791 GGCCCGGGCTGCGGCAGCGGCGG - Intronic
1094564938 12:31590855-31590877 TTCCCGGGCGGCGGCGGCGGCGG - Exonic
1094624172 12:32107011-32107033 GGCCCGGGCTGCGGCGGCCGCGG - Intronic
1094653427 12:32399387-32399409 TCCCCGGCCGGAGGAGGCGGCGG + Intergenic
1095261663 12:40105624-40105646 GGCGCGGGCGGCGGCGGCGTCGG - Exonic
1095476220 12:42589688-42589710 CTGTCGGGCGGCGGCGGCCGCGG + Intronic
1096482454 12:51951704-51951726 CTGCTGGGCTGCGGCGGCGGCGG + Exonic
1096482457 12:51951713-51951735 TGCGGCGGCGGCGGCGGCGGCGG + Exonic
1096598672 12:52714392-52714414 AGCCGGGGTGGCGGCGGCGGCGG - Intergenic
1096774399 12:53955350-53955372 TACGCGGCGGGCGGCGGCGGTGG + Exonic
1096784406 12:54009030-54009052 CGAGCGGGCGGCGGCGGCGGCGG - Intronic
1096784415 12:54009057-54009079 GGCGCGGGCGGCGGCGGCGGCGG - Intronic
1096809768 12:54161851-54161873 CTCCCAGGCGGAGGCGGCAGTGG + Intergenic
1096983738 12:55743397-55743419 CCCCGCGGCGGCGGCGGCGGCGG + Exonic
1097057426 12:56258298-56258320 GCTCCCGGCGGCGGCGGCGGCGG + Exonic
1097057440 12:56258341-56258363 GGCCCAGGCGGCGGCTGCGGTGG + Exonic
1097107673 12:56634960-56634982 GCCGCAGGCGGCGGCGGCGGCGG + Intronic
1097264418 12:57737512-57737534 TCCCCCGGCGGCGGCGGCGGTGG + Exonic
1097648165 12:62260718-62260740 TATCCGGGGAGCGGCGGCGGCGG + Intronic
1098105958 12:67069303-67069325 GCTCCGGGCGGCGGCGGCGGCGG + Intergenic
1098123823 12:67269638-67269660 TCCAGTGGCGGCGGCGGCGGCGG + Exonic
1098161156 12:67649041-67649063 CGGCCGGGAGGCGGCGGCGGCGG + Exonic
1098426088 12:70366619-70366641 CTGTCGCGCGGCGGCGGCGGTGG + Exonic
1098779263 12:74664191-74664213 TCCCGGGGCGGGGGCGGCAGCGG + Intergenic
1100089706 12:90954684-90954706 AACCTGGGCGGCGGTGGCGGCGG - Exonic
1100315627 12:93441999-93442021 TTCCCGAGGGGCCTCGGCGGCGG - Exonic
1100391438 12:94148881-94148903 GACGCGGGCGGCGGCGGCGGCGG - Exonic
1100423410 12:94459802-94459824 TCCGAGGGCGGCGGCGGCGGCGG + Exonic
1100565625 12:95790911-95790933 CCCCCGGGCGGCAGCGGCAGCGG - Intronic
1100632284 12:96400587-96400609 ACCCCTGCCGGCGGCGGCGGAGG + Intergenic
1100869442 12:98894979-98895001 TGCCCTGGCGGCAGCGGCGGCGG + Intronic
1101023150 12:100573679-100573701 GGCCCAGGCGGCGGCGGCAGCGG + Intronic
1101354740 12:103966214-103966236 TTCCCTGGCTGCGGCGGTGGTGG + Intronic
1101592695 12:106138566-106138588 TCCCCGAGAGGCGGTGGCGGGGG - Exonic
1101592897 12:106139191-106139213 GGCCACGGCGGCGGCGGCGGCGG + Exonic
1101605886 12:106247625-106247647 CACCGCGGCGGCGGCGGCGGCGG - Exonic
1101910519 12:108857545-108857567 GGCCCGGGCGGCGGTGGCGGTGG - Exonic
1102003571 12:109573848-109573870 GGCCGGGGAGGCGGCGGCGGCGG + Exonic
1102197411 12:111034862-111034884 GGCTCTGGCGGCGGCGGCGGCGG - Intronic
1102254055 12:111406024-111406046 TTCCCCGGCGGCGGCGGCCCGGG + Exonic
1102370949 12:112382092-112382114 GGCCGCGGCGGCGGCGGCGGCGG - Exonic
1102519934 12:113471805-113471827 TTCCCCGGTGGCGGAGGCGCCGG + Exonic
1102853962 12:116277522-116277544 TTCGCGCTCCGCGGCGGCGGCGG - Intergenic
1102854052 12:116277792-116277814 GTCCGGAGTGGCGGCGGCGGCGG + Intergenic
1103433024 12:120904099-120904121 CTCACCCGCGGCGGCGGCGGCGG + Exonic
1103433066 12:120904243-120904265 CGCTCGGGCGGCGGCGGCGGCGG + Exonic
1103509924 12:121467261-121467283 CTCCGGGCGGGCGGCGGCGGCGG - Intronic
1103521247 12:121537910-121537932 ACCCTCGGCGGCGGCGGCGGCGG + Intronic
1103563598 12:121804676-121804698 CTCCGCCGCGGCGGCGGCGGCGG - Intronic
1103623895 12:122204563-122204585 ATGCCGGGCGGCGGCGGCGGCGG - Exonic
1103764668 12:123271660-123271682 CGCGAGGGCGGCGGCGGCGGCGG + Exonic
1103807472 12:123584559-123584581 CAGCGGGGCGGCGGCGGCGGCGG + Exonic
1103856134 12:123972582-123972604 CTCCCGGCGGGCGGCGGTGGGGG + Exonic
1103932225 12:124456973-124456995 TGCCCAGGCGGCGTCCGCGGAGG - Intronic
1103954249 12:124567586-124567608 CTCCCCGGCGGCCGCGGCGGCGG + Intronic
1104049560 12:125186486-125186508 AGCCGCGGCGGCGGCGGCGGCGG + Intergenic
1104088244 12:125494349-125494371 TTCCAGGGAGGAGGGGGCGGAGG - Intronic
1104289585 12:127455674-127455696 TGCCCGGGCGGGGGCGCCAGAGG + Intergenic
1104376182 12:128267096-128267118 GGCCCGGGCGGGGGCGGGGGCGG + Intergenic
1104869152 12:131982206-131982228 CTCCCGGGCAGCTGCGGCAGTGG - Exonic
1105217487 13:18297627-18297649 TGGCCGGGCAGCGGCGGCGGCGG + Intergenic
1105349446 13:19602253-19602275 TTCCCGGGCGGCGGGGGAAGCGG + Intergenic
1105472069 13:20703735-20703757 GCTCGGGGCGGCGGCGGCGGCGG + Intronic
1106208406 13:27620502-27620524 ATCCGCGGCGGCGGCGGCGGCGG - Intergenic
1106242876 13:27924564-27924586 CCTCCGGGGGGCGGCGGCGGCGG - Exonic
1106269365 13:28138714-28138736 CTCGCTGGCGGCGGCGGTGGCGG + Exonic
1106322962 13:28659270-28659292 GTCCCCGGTGGCGGCGGCGGCGG + Intronic
1106498767 13:30307396-30307418 CTCGGCGGCGGCGGCGGCGGCGG - Exonic
1106512388 13:30422369-30422391 CTCCCTGGCCGCGGCGGCGGTGG + Intergenic
1106516974 13:30464814-30464836 TGCGGGCGCGGCGGCGGCGGCGG + Intronic
1106735834 13:32586912-32586934 GGCCGGGGCGGCGGCGGCGGCGG + Intronic
1106956311 13:34942627-34942649 CTCCCCCGCGGAGGCGGCGGGGG - Exonic
1107467807 13:40665824-40665846 GGCCCGGGCGGCGGGGGCTGCGG + Exonic
1107467840 13:40665927-40665949 CTCCGTGGCGGCGGCGGTGGCGG - Exonic
1107481568 13:40789768-40789790 TTCCCGAGCGGCGGGGGAAGCGG + Intronic
1107534077 13:41311281-41311303 TTGGCCAGCGGCGGCGGCGGCGG - Exonic
1107604013 13:42040752-42040774 AGCCGGGGCGGCGGCGGCGGCGG + Intronic
1107624844 13:42272051-42272073 TGCGGCGGCGGCGGCGGCGGCGG + Intergenic
1108063189 13:46553150-46553172 TGCGGCGGCGGCGGCGGCGGCGG - Intronic
1108227458 13:48303947-48303969 TTCCGCGGCGGCAGCGGCGGCGG - Exonic
1108685427 13:52815335-52815357 TGCCCAGGAGCCGGCGGCGGGGG + Intergenic
1109284853 13:60397592-60397614 TCCCCTGGAGGCGGCGGCGGCGG + Intronic
1110119760 13:71866534-71866556 TCTACCGGCGGCGGCGGCGGCGG - Exonic
1110705922 13:78602145-78602167 GGCCCGGGGGGCGGCGGCGGCGG - Exonic
1110705941 13:78602181-78602203 GGCCCGGGCGGCGGCCCCGGGGG - Exonic
1111396408 13:87673181-87673203 TTCCTGGAGGGCGGGGGCGGGGG - Intronic
1111676807 13:91398645-91398667 GAGCCGGGCGGCGGAGGCGGCGG + Intergenic
1111951316 13:94711549-94711571 GCCCGCGGCGGCGGCGGCGGCGG + Exonic
1112216317 13:97434313-97434335 CCCCTGGGCGCCGGCGGCGGCGG - Exonic
1112216366 13:97434432-97434454 GTCGCGGGCGGCGGCGGCGGCGG + Exonic
1112290893 13:98143362-98143384 CCCGCGGGCGGCGGCGGCGCGGG - Intronic
1112504916 13:99969809-99969831 CTCCGAGGTGGCGGCGGCGGCGG + Intronic
1112505078 13:99970573-99970595 TGCGCGGGCGCCGGCGGCGGCGG + Exonic
1112507197 13:99982133-99982155 CTCCGCCGCGGCGGCGGCGGCGG + Exonic
1112507809 13:99985442-99985464 GTCCCCAGCGGCGGCGGCAGCGG + Exonic
1112560249 13:100506370-100506392 TTCGCGGGCGGGGGTGGGGGCGG + Intronic
1113157553 13:107341042-107341064 GTTCGGGGCGGCGGGGGCGGTGG - Intronic
1113200742 13:107866175-107866197 TCCCCGGGAGACGGCGGCGGCGG - Exonic
1113312039 13:109141001-109141023 GGCCCGGGCGGGGGCGGGGGCGG - Exonic
1113378125 13:109782935-109782957 TCCCCCGGGGCCGGCGGCGGTGG + Exonic
1113655606 13:112066658-112066680 CGCGCGCGCGGCGGCGGCGGCGG - Intergenic
1113655926 13:112067761-112067783 GGCGGGGGCGGCGGCGGCGGCGG + Exonic
1113656042 13:112068240-112068262 CTCGGTGGCGGCGGCGGCGGCGG + Exonic
1113656114 13:112068543-112068565 GGCCGTGGCGGCGGCGGCGGCGG + Exonic
1114037906 14:18646470-18646492 CTTTCGGGAGGCGGCGGCGGCGG - Intergenic
1114265349 14:21070166-21070188 GTCCCGCGCGGAGGCGGGGGCGG + Intronic
1114270678 14:21098333-21098355 GGAGCGGGCGGCGGCGGCGGCGG + Exonic
1114485169 14:23057653-23057675 GGCCCGCGCGGCGGGGGCGGGGG + Intergenic
1114806982 14:25848672-25848694 TTCACGGGGGGCAGGGGCGGGGG + Intergenic
1115028400 14:28767499-28767521 GCCGGGGGCGGCGGCGGCGGCGG - Exonic
1115399236 14:32939125-32939147 GGCCGTGGCGGCGGCGGCGGCGG - Intronic
1115474485 14:33800384-33800406 TCCCCGCAGGGCGGCGGCGGTGG + Exonic
1115761314 14:36581065-36581087 CAGCCGTGCGGCGGCGGCGGCGG - Exonic
1116821761 14:49634049-49634071 TTCCGGCGCGGCGGCGGCGACGG + Exonic
1116835801 14:49768218-49768240 GAGCCGGGCGGCGGCGGCGCGGG - Exonic
1116916665 14:50532327-50532349 TTCGCGGGCGGCCGGGGAGGGGG - Intronic
1117353516 14:54902671-54902693 TTCCCGAACGGCAGCGGCTGCGG - Exonic
1117424422 14:55580253-55580275 TGCGGCGGCGGCGGCGGCGGCGG + Intronic
1117478304 14:56118757-56118779 GTCCCGGGCAGCGGCGCGGGCGG + Intronic
1117526656 14:56613984-56614006 AACCCGGGAGGCGGAGGCGGAGG - Intronic
1117623187 14:57608783-57608805 TGGCCGGGGGGGGGCGGCGGGGG + Intronic
1117699236 14:58396441-58396463 TTCCCGGGCACGGGCGGCTGAGG - Intronic
1117875928 14:60249722-60249744 GGCCTGCGCGGCGGCGGCGGCGG + Intronic
1118607698 14:67515403-67515425 GCCCCCGGCGGCGGCGGCGGCGG + Intronic
1118748537 14:68790865-68790887 GTCGCGGGCGGTGGCGGGGGCGG - Intronic
1118797016 14:69152986-69153008 GGCGCGAGCGGCGGCGGCGGCGG - Exonic
1118849478 14:69573083-69573105 GGCCGCGGCGGCGGCGGCGGCGG + Exonic
1118925774 14:70188738-70188760 GTCCCGGCCGCGGGCGGCGGGGG + Exonic
1118971505 14:70641916-70641938 GTCCGAGGCGGCGGCGGCGGCGG + Exonic
1119196248 14:72718847-72718869 AACCCGGGAGGCGGAGGCGGAGG - Intronic
1119286381 14:73458341-73458363 GGCCAGGGCGGAGGCGGCGGGGG - Intronic
1119410310 14:74426152-74426174 CTGCGCGGCGGCGGCGGCGGCGG - Intergenic
1119497350 14:75091442-75091464 AGCCCGGGAGGAGGCGGCGGGGG - Exonic
1119743209 14:77027295-77027317 TTCCACCGCAGCGGCGGCGGCGG + Exonic
1119821035 14:77616445-77616467 TACCTGGCCGGCGGCGGCTGCGG + Exonic
1120168027 14:81220933-81220955 CTCGGCGGCGGCGGCGGCGGCGG - Intronic
1120168028 14:81220936-81220958 TCTCTCGGCGGCGGCGGCGGCGG - Intronic
1121199584 14:92106318-92106340 TCCCAGGGCGGGGGCCGCGGGGG + Intronic
1121352633 14:93185252-93185274 GTCTCCGGCGGCGGCGACGGGGG + Exonic
1121417508 14:93789096-93789118 GGCGCTGGCGGCGGCGGCGGGGG - Intergenic
1121767795 14:96502528-96502550 GCCCAGGGCGGCAGCGGCGGCGG + Exonic
1122081696 14:99271316-99271338 TGCGGCGGCGGCGGCGGCGGCGG - Intronic
1122108759 14:99480797-99480819 CCCCCAGGCGGTGGCGGCGGTGG + Exonic
1122183501 14:99971995-99972017 CGACCCGGCGGCGGCGGCGGCGG - Intronic
1122270766 14:100567682-100567704 GGCCCGGGCCGCTGCGGCGGGGG - Intronic
1122444992 14:101761698-101761720 AGCCACGGCGGCGGCGGCGGCGG - Intergenic
1122445012 14:101761776-101761798 TCCCCGGGCGGCGGCGGCGGCGG + Exonic
1122445045 14:101761856-101761878 GGCAGGGGCGGCGGCGGCGGCGG + Exonic
1122863246 14:104591884-104591906 TTCTGGGGCGGGGGCGGAGGCGG - Intronic
1122993302 14:105248988-105249010 GGCGCGGGCGGCGGCGGCGCTGG - Exonic
1123024886 14:105419879-105419901 GGCCTCGGCGGCGGCGGCGGCGG + Exonic
1123024888 14:105419882-105419904 CTCGGCGGCGGCGGCGGCGGCGG + Exonic
1123024928 14:105420013-105420035 GTCCGGGCCGGCGGCGGCGGAGG - Exonic
1123041294 14:105491324-105491346 GCCCCGGGCCGCGGCGGAGGCGG + Exonic
1123048469 14:105529714-105529736 TGCAGCGGCGGCGGCGGCGGCGG - Exonic
1124109483 15:26773048-26773070 GGCCAGCGCGGCGGCGGCGGCGG - Exonic
1124109571 15:26773277-26773299 GTCCCGTGCGGCGGCCGCCGAGG - Intronic
1124484434 15:30102501-30102523 TTCCCTGGTGGCGGCGGCGGTGG - Intergenic
1124497527 15:30195697-30195719 TTCCCAGGCGGTAGCGGGGGCGG + Intergenic
1124519149 15:30394723-30394745 TTCCCTGGTGGCGGCGGCGGTGG + Intergenic
1124539507 15:30571498-30571520 TTCCCTGGTGGCGGCGGCGGTGG - Intergenic
1124595645 15:31089526-31089548 TTCCCGGGCAGCGGTGGATGGGG + Intronic
1124640364 15:31392823-31392845 GTCGCGGGCGGGGGCGGGGGCGG - Intronic
1124652505 15:31484002-31484024 GGCCGTGGCGGCGGCGGCGGCGG + Exonic
1124746062 15:32342994-32343016 TTCCCAGGCGGTAGCGGGGGCGG - Intergenic
1124759143 15:32436074-32436096 TTCCCTGGTGGCGGCGGCGGTGG + Intergenic
1124974460 15:34520182-34520204 TTCCATGGTGGCAGCGGCGGTGG + Intergenic
1125485601 15:40108801-40108823 GGCAGGGGCGGCGGCGGCGGCGG + Exonic
1125508783 15:40282023-40282045 GCCCCGGGCCGCAGCGGCGGCGG + Exonic
1125516458 15:40323826-40323848 TGACGGGCCGGCGGCGGCGGCGG + Intergenic
1125522939 15:40358261-40358283 AGCCGCGGCGGCGGCGGCGGCGG - Exonic
1125536063 15:40441607-40441629 CGGCCGGGCGGCGGCGGCGCGGG + Intronic
1125852803 15:42920628-42920650 TTTACTGGCGGCGGCGGCGGCGG + Intronic
1125916578 15:43493131-43493153 TTCGCGGCCGGTGGCGGCGGTGG - Exonic
1126113289 15:45187761-45187783 TTCCGCGGGGGGGGCGGCGGCGG - Intronic
1126767003 15:52019440-52019462 GGGCCCGGCGGCGGCGGCGGCGG + Intronic
1126786219 15:52179696-52179718 TTCCCGGGCGGGGACGGCGGGGG - Intronic
1127144083 15:56007190-56007212 GATCCGGGCGGCGGCGGCGGCGG + Intergenic
1127588392 15:60398516-60398538 TTCCCGGGGGGCGCCCGGGGAGG + Intronic
1127606312 15:60591834-60591856 TGCCCGGCCGGCGGCCGCTGAGG + Intronic
1128028572 15:64460582-64460604 GTCCCGGATCGCGGCGGCGGCGG + Intergenic
1128056475 15:64703240-64703262 GGGCGGGGCGGCGGCGGCGGCGG - Exonic
1128067852 15:64775589-64775611 CGCCGCGGCGGCGGCGGCGGCGG + Intergenic
1128280064 15:66387141-66387163 GTCCCGGGCGGGTGGGGCGGGGG + Exonic
1128293566 15:66497791-66497813 TTTCCGGGAGTCGGCGGCGATGG - Exonic
1128743303 15:70097455-70097477 TGCAGCGGCGGCGGCGGCGGCGG - Exonic
1129116455 15:73367936-73367958 AGCCGGGGCGGCGGCAGCGGCGG - Exonic
1129189177 15:73927564-73927586 TCGGGGGGCGGCGGCGGCGGCGG - Exonic
1129288020 15:74541289-74541311 TTTTCGGGCGGCGGAGGAGGCGG - Exonic
1129348282 15:74938167-74938189 CGCGCGGCCGGCGGCGGCGGGGG + Exonic
1129483107 15:75843380-75843402 TTCCCAGGCGGTAGCGGGGGCGG + Exonic
1129644803 15:77420070-77420092 TTGCTCGGCGGCGGCGGCCGTGG - Exonic
1129676039 15:77632810-77632832 AGCGCAGGCGGCGGCGGCGGCGG - Intronic
1130261139 15:82355270-82355292 TCCCCCGGCGGCGGCAGCAGCGG - Intergenic
1130280096 15:82513748-82513770 TCCCCCGGCGGCGGCAGCAGCGG + Intergenic
1130362964 15:83207692-83207714 AGCGCGCGCGGCGGCGGCGGCGG - Exonic
1130370802 15:83284336-83284358 CGGCCGGGAGGCGGCGGCGGGGG - Intronic
1130471471 15:84229934-84229956 TCCCCCGGCGGCGGCAGCAGCGG + Intergenic
1130478965 15:84344505-84344527 TCCCCCGGCGGCGGCAGCAGCGG + Intergenic
1130492805 15:84443626-84443648 TCCCCCGGCGGCGGCAGCAGCGG - Intergenic
1130508770 15:84570981-84571003 TTCCCAGGCGGTAGCGGGGGCGG - Intergenic
1130564419 15:84981683-84981705 AGCCGGGGAGGCGGCGGCGGCGG + Intronic
1130593765 15:85234561-85234583 TCCCCCGGCGGCGGCAGCAGCGG + Intergenic
1130656437 15:85794781-85794803 CTCTGAGGCGGCGGCGGCGGCGG - Exonic
1130908602 15:88256349-88256371 CCACCCGGCGGCGGCGGCGGCGG - Exonic
1130908605 15:88256352-88256374 CTCCCACCCGGCGGCGGCGGCGG - Exonic
1131186089 15:90275286-90275308 TTCCACAGGGGCGGCGGCGGCGG + Exonic
1131431750 15:92393915-92393937 GTCCGGGCCGGCGGCGGCAGCGG - Exonic
1131827014 15:96330399-96330421 CTCGGCGGCGGCGGCGGCGGCGG + Intronic
1132185928 15:99801579-99801601 TTCCCTGGTGGCAGCGGCGGTGG - Intergenic
1132368658 15:101277423-101277445 GGGCTGGGCGGCGGCGGCGGCGG - Exonic
1132429752 15:101751119-101751141 TTCCCTGGTGGCAGCGGCGGTGG + Intergenic
1132641875 16:981778-981800 AGCCTCGGCGGCGGCGGCGGCGG + Intergenic
1132641877 16:981781-981803 CTCGGCGGCGGCGGCGGCGGCGG + Intergenic
1132683804 16:1154043-1154065 TTCCCGGCCGGCGGGGGGCGGGG + Intronic
1132753153 16:1468274-1468296 TGCCAAGGCGGCGGCGGTGGGGG - Intronic
1132757570 16:1493512-1493534 GTCCGGGGCCGCGGCGGCCGTGG + Exonic
1132841029 16:1978639-1978661 TTCCCAGGGGGTGGGGGCGGCGG - Exonic
1132851507 16:2026937-2026959 CTCGGGGGCGGCGGCGGCGCTGG - Exonic
1132877961 16:2148666-2148688 TCCCCTGGCGGCGGCGGCGGCGG - Exonic
1132879504 16:2155786-2155808 TTCCCGGCCGGCGGCCGAGGGGG + Exonic
1133040879 16:3059242-3059264 CTCCCGCGCAGGGGCGGCGGCGG + Exonic
1133053864 16:3135097-3135119 TTCGGGGGCGGGGGCGGGGGCGG + Exonic
1133156456 16:3880144-3880166 GCCGCGGCCGGCGGCGGCGGCGG - Exonic
1133156550 16:3880407-3880429 TTTCCTCACGGCGGCGGCGGCGG - Exonic
1133156583 16:3880505-3880527 GAGCCCGGCGGCGGCGGCGGCGG - Exonic
1133784351 16:8963356-8963378 AGCCGGGGCGGCGGCGGCGGCGG + Exonic
1133784412 16:8963568-8963590 CCCCGCGGCGGCGGCGGCGGCGG - Intronic
1133791613 16:9013406-9013428 CTCCCGGGAGGAGGAGGCGGCGG + Intergenic
1134163952 16:11915555-11915577 CTCCCTGGCGGCGGCGGCCGAGG - Exonic
1134588650 16:15434502-15434524 CTCCCGGGCGCTGGCGGCGGCGG + Exonic
1134656110 16:15949617-15949639 AGCGCTGGCGGCGGCGGCGGCGG - Exonic
1135023798 16:18983990-18984012 GGCCGGGGAGGCGGCGGCGGCGG + Exonic
1135335723 16:21599639-21599661 AGCTCGGGCGGTGGCGGCGGTGG + Exonic
1135691316 16:24539911-24539933 GTCCGAGGCGGCGGCGGCGGCGG + Intronic
1135712498 16:24729683-24729705 GTCGGCGGCGGCGGCGGCGGCGG + Intronic
1135821888 16:25692390-25692412 CTCCCGGCTCGCGGCGGCGGCGG - Exonic
1136226503 16:28863898-28863920 TCCGGCGGCGGCGGCGGCGGCGG - Intronic
1136226504 16:28863901-28863923 AGCTCCGGCGGCGGCGGCGGCGG - Intronic
1136365177 16:29806411-29806433 GGCCCGGGCGGCGGCGGCGGCGG - Intronic
1136784282 16:32925518-32925540 GCCCGGGCCGGCGGCGGCGGGGG + Intergenic
1136885502 16:33928288-33928310 GCCCGGGCCGGCGGCGGCGGGGG - Intergenic
1137531578 16:49281778-49281800 ATTCAGAGCGGCGGCGGCGGCGG - Exonic
1137617702 16:49856948-49856970 CTCCTGGGCAGCGGCGGCGGCGG + Intronic
1137618203 16:49858855-49858877 ATCCCAGGCGCCGGCGGGGGTGG - Intergenic
1137708031 16:50548683-50548705 TCGCGAGGCGGCGGCGGCGGCGG - Intronic
1138105708 16:54286207-54286229 CTCCGCGGCGGCGACGGCGGCGG + Exonic
1138247623 16:55479277-55479299 TGCGGCGGCGGCGGCGGCGGCGG + Exonic
1138360748 16:56425438-56425460 GCCCGGCGCGGCGGCGGCGGCGG - Exonic
1138450775 16:57092569-57092591 CGGGCGGGCGGCGGCGGCGGCGG - Exonic
1138619190 16:58198016-58198038 CCCCCAGGAGGCGGCGGCGGCGG + Intergenic
1139364882 16:66427174-66427196 ATCCCGGGCCGAGGCAGCGGCGG - Intergenic
1139402929 16:66696615-66696637 CAGTCGGGCGGCGGCGGCGGCGG - Exonic
1139528147 16:67528982-67529004 CCACCGGGCGGCGCCGGCGGGGG - Intronic
1139534391 16:67562603-67562625 TTCTTTGGCGGCAGCGGCGGCGG + Exonic
1140187426 16:72787741-72787763 CCCACCGGCGGCGGCGGCGGTGG - Exonic
1140187429 16:72787744-72787766 GTCCCCACCGGCGGCGGCGGCGG - Exonic
1140209184 16:72957817-72957839 TGCCGGGGCGGCGGCGGCGGCGG - Exonic
1140221603 16:73048091-73048113 TTCCGGGCGGGCGGCGGCAGAGG - Exonic
1140225224 16:73071478-73071500 ATCGGCGGCGGCGGCGGCGGCGG - Intergenic
1140927765 16:79599919-79599941 TGGCGGAGCGGCGGCGGCGGCGG - Exonic
1141054614 16:80804013-80804035 GCCCGCGGCGGCGGCGGCGGCGG - Intronic
1141079181 16:81035879-81035901 CTCGGAGGCGGCGGCGGCGGCGG + Exonic
1141582723 16:85011322-85011344 CTCCCGGCCTGCGGCGGCGGCGG + Exonic
1141703416 16:85652540-85652562 ATTCCAGGCGGCGGCGGCGGCGG + Intronic
1141835774 16:86538315-86538337 TTCCAGGGTGGCGGCGGCAGTGG + Intronic
1141989604 16:87602549-87602571 GGCTCGGGCGGCGGCGGCGGCGG - Intronic
1142156302 16:88534221-88534243 TGGCCGGGCGGCGGGGGGGGCGG - Exonic
1142188597 16:88706579-88706601 TACCTGGGCCGCGGCGCCGGGGG - Exonic
1142378758 16:89720606-89720628 TTCCCGGGCGAGGACGGGGGCGG - Intronic
1203086939 16_KI270728v1_random:1189524-1189546 GCCCGGGCCGGCGGCGGCGGGGG + Intergenic
1203104392 16_KI270728v1_random:1345713-1345735 AGCCGGGGCGGCGGCGACGGCGG + Intergenic
1203129122 16_KI270728v1_random:1616655-1616677 AGCCGGGGCGGCGGCGACGGCGG - Intergenic
1142586662 17:978869-978891 TCCGCGGGGGTCGGCGGCGGAGG + Intronic
1142664807 17:1456385-1456407 TTCCCGGGCCCGGGCTGCGGGGG + Intronic
1142762420 17:2050230-2050252 GTCCCCGGGCGCGGCGGCGGCGG + Intergenic
1142764082 17:2056125-2056147 GGCCCGGGCGGCGGCCGCGCGGG - Intronic
1142764329 17:2057105-2057127 CTGCGGGGCGGCGGCGGCGGCGG + Exonic
1142764361 17:2057216-2057238 TCCGCGGCAGGCGGCGGCGGAGG - Exonic
1142799709 17:2337548-2337570 TGCGGCGGCGGCGGCGGCGGCGG + Exonic
1142836794 17:2593585-2593607 GTCTGGGGCGGCGGCGGCGGCGG + Intronic
1142852643 17:2711605-2711627 TTCCCGGGCGCTGTCGGCCGGGG + Intronic
1143223653 17:5282371-5282393 TCTCTGGGCGGCGGCGGCGGCGG + Exonic
1143499456 17:7330356-7330378 TCCCCGGCCGGCAGCGGTGGGGG + Intergenic
1143527223 17:7479603-7479625 GTCAGCGGCGGCGGCGGCGGCGG - Intronic
1143590781 17:7885056-7885078 GGCGGGGGCGGCGGCGGCGGGGG - Exonic
1143590787 17:7885065-7885087 TTACCTGGCGGCGGGGGCGGCGG - Exonic
1143590888 17:7885332-7885354 AGCCGGGGTGGCGGCGGCGGCGG - Intronic
1143633398 17:8151297-8151319 TTCCCTGGCGACCGTGGCGGCGG - Intronic
1144021037 17:11240647-11240669 TGCAGAGGCGGCGGCGGCGGCGG - Intergenic
1144021165 17:11241068-11241090 GCTCCGGGCGGCGGCGGCGGCGG - Intergenic
1144245215 17:13356108-13356130 TTCCTGGCCGGCGGGTGCGGTGG - Intergenic
1144269234 17:13601266-13601288 GTCCCGGGAGGCAGCGGCCGGGG + Exonic
1144339727 17:14301585-14301607 CTCACCGGCGGCGGGGGCGGCGG - Exonic
1144565054 17:16353144-16353166 GTCGCGGGAGTCGGCGGCGGCGG + Exonic
1144565057 17:16353153-16353175 GTCGGCGGCGGCGGCGGCGGTGG + Exonic
1144840501 17:18183087-18183109 GCTCCGGGCGGCGGCGGCAGCGG + Intronic
1144910060 17:18673040-18673062 TCCCCAGGCGGCGGCGGCGGCGG - Exonic
1145925654 17:28644951-28644973 CGCGCCGGCGGCGGCGGCGGCGG - Intronic
1146058655 17:29593411-29593433 TCCTCGCGAGGCGGCGGCGGCGG - Intronic
1146132630 17:30291953-30291975 CTCGGCGGCGGCGGCGGCGGCGG + Exonic
1146219841 17:31008729-31008751 GTCCCCAGCGGCGGAGGCGGCGG - Intergenic
1146332340 17:31937420-31937442 CTCCGCGGCGGCAGCGGCGGGGG + Exonic
1146339609 17:32007676-32007698 GACGTGGGCGGCGGCGGCGGCGG - Intergenic
1146371135 17:32266154-32266176 TCCGGGGGCGGCGGCGGCTGCGG - Exonic
1146403673 17:32519464-32519486 GGCTCTGGCGGCGGCGGCGGGGG + Intronic
1146956056 17:36936902-36936924 GGCCCGGGCGGCGACAGCGGCGG + Intronic
1147144573 17:38477665-38477687 GCCCGGGCCGGCGGCGGCGGGGG + Exonic
1147168699 17:38606043-38606065 GCCCGGGGCGGCGGGGGCGGGGG + Intergenic
1147200645 17:38799425-38799447 GCCCGGGGCGGCGGCGGCGGCGG + Exonic
1147307404 17:39573634-39573656 CGGCCCGGCGGCGGCGGCGGCGG - Intergenic
1147440209 17:40443286-40443308 TTCAGATGCGGCGGCGGCGGCGG + Intergenic
1147686261 17:42288509-42288531 GTTCCTGGCGGCGGCGGCAGCGG - Exonic
1147719827 17:42532209-42532231 CACCTGGGCGGCGGCGGCGGCGG - Intergenic
1147943502 17:44066600-44066622 GCCGCGGCCGGCGGCGGCGGCGG + Exonic
1147967140 17:44199543-44199565 TCCTCCGGCGGCGGCGACGGCGG + Intronic
1147971148 17:44219608-44219630 TGCTGTGGCGGCGGCGGCGGCGG + Intronic
1147971265 17:44219980-44220002 GACCCGGGCGGCCGAGGCGGAGG + Intronic
1148126938 17:45241987-45242009 TCTCCGGGCAGCGGCGGCGCAGG - Exonic
1148126971 17:45242080-45242102 CCTCCGGGAGGCGGCGGCGGCGG - Exonic
1148268240 17:46243606-46243628 TCTGCGGGCGGCGGCGGCGCGGG + Intergenic
1148417471 17:47517996-47518018 AACCCGGGAGGCGGAGGCGGAGG + Intergenic
1148440414 17:47709018-47709040 TCGCCCGGCGGGGGCGGCGGCGG - Exonic
1148467233 17:47872495-47872517 CTCAGTGGCGGCGGCGGCGGCGG + Intergenic
1148562657 17:48614714-48614736 TTTTGAGGCGGCGGCGGCGGCGG + Exonic
1148566015 17:48633511-48633533 TACCTGGGCGGCGGCGGTGCCGG + Intronic
1148664099 17:49361921-49361943 GGCCGGGGCGGCGGAGGCGGAGG - Intronic
1148698627 17:49575655-49575677 CCCACCGGCGGCGGCGGCGGCGG - Intergenic
1148786836 17:50149732-50149754 GGGGCGGGCGGCGGCGGCGGCGG + Exonic
1148936235 17:51166410-51166432 CACCCGGGAGCCGGCGGCGGAGG - Intronic
1149430527 17:56593394-56593416 CTCACAGGCGGCGGCGGCGGCGG - Intergenic
1149430615 17:56593724-56593746 TCCAGCGGCGGCGGCGGCGGCGG - Exonic
1149430656 17:56593888-56593910 TCCCGGGCCGGCGGCGGCGCAGG - Exonic
1149461538 17:56833692-56833714 ATCCCCGGCGGCGGCGGCGCCGG + Exonic
1150373503 17:64661881-64661903 GTCCCCGGCGGCGGGGGCGGCGG + Exonic
1150376136 17:64683360-64683382 ACCCCGGGGGGCGGGGGCGGAGG - Intergenic
1150407973 17:64919164-64919186 GACGTGGGCGGCGGCGGCGGCGG + Intronic
1150423168 17:65056598-65056620 CGCCGAGGCGGCGGCGGCGGCGG - Exonic
1150692377 17:67377489-67377511 GAGCCGAGCGGCGGCGGCGGCGG + Intronic
1150747248 17:67825800-67825822 GACGTGGGCGGCGGCGGCGGTGG - Exonic
1150778724 17:68101885-68101907 GTCCCTGGCGGCTGGGGCGGCGG - Intergenic
1150791895 17:68205762-68205784 GACTTGGGCGGCGGCGGCGGCGG - Intergenic
1150791966 17:68205968-68205990 GGCGGGGGCGGCGGCGGCGGCGG + Intergenic
1151477828 17:74353850-74353872 TTACTGAGCGGAGGCGGCGGGGG - Intronic
1151558692 17:74859883-74859905 TGCGGCGGCGGCGGCGGCGGCGG + Intronic
1151642397 17:75405632-75405654 CGACCGGGCGGCGGCAGCGGCGG - Intronic
1151755336 17:76072451-76072473 GTCCCAGGCGGCGGCGGCGGCGG - Exonic
1151783853 17:76265669-76265691 ACGCCGGGCGGCGGCGGGGGCGG + Intronic
1151828692 17:76537568-76537590 TTGCTCGGCGGCGGCGGTGGCGG + Exonic
1152049142 17:77958952-77958974 GTCCTAGGCGGCGGCGGCGGCGG - Intergenic
1152075520 17:78157323-78157345 TTCAGCAGCGGCGGCGGCGGCGG + Intronic
1152077508 17:78168584-78168606 TTCCGCGGCGGCGGCAGCGGCGG + Exonic
1152349695 17:79777927-79777949 GCCCCGGGCGGGGGCGGGGGCGG - Intergenic
1152353636 17:79796793-79796815 GGCCGTGGCGGCGGCGGCGGCGG - Intronic
1152396336 17:80035853-80035875 CTCACTGGCGGCGGCAGCGGCGG - Intergenic
1152552316 17:81035704-81035726 GGCCGGGGCGGCGGGGGCGGCGG + Intronic
1152579972 17:81161547-81161569 TTCCCAGGCGGCCGGGGTGGTGG + Intronic
1152714367 17:81891438-81891460 TCCCAGGGCGGCCGCGGCGGTGG - Exonic
1152782629 17:82232904-82232926 TTCCTGGGGGGCGGCGGGGGGGG + Intronic
1152834451 17:82520141-82520163 CCCCCGGGCGGCGGCGGCCATGG + Exonic
1152921369 17:83068173-83068195 GTCCCGGGAGGCGACAGCGGGGG + Intergenic
1152921384 17:83068208-83068230 GTCCCGGGAGGCGACAGCGGGGG + Intergenic
1152921398 17:83068242-83068264 GTCCCGGGAGGCGACAGCGGGGG + Intergenic
1152921409 17:83068276-83068298 GTCCCGGGAGGCGACAGCGGCGG + Intergenic
1152921422 17:83068310-83068332 GTCCCGGGAGGCGACAGCGGGGG + Intergenic
1152921434 17:83068344-83068366 GTCCCGGGAGGCGACAGCGGCGG + Intergenic
1152921445 17:83068378-83068400 GTCCCGGGAGGCGACAGCGGCGG + Intergenic
1152921458 17:83068412-83068434 GTCCCGGGAGGCGACAGCGGGGG + Intergenic
1152921472 17:83068446-83068468 GTCCCGGGAGGCGACAGCGGGGG + Intergenic
1152921483 17:83068480-83068502 GTCCCGGGAGGCGACAGCGGCGG + Intergenic
1152921496 17:83068514-83068536 GTCCCGGGAGGCGACAGCGGGGG + Intergenic
1152921510 17:83068548-83068570 GTCCCGGGAGGCGACAGCGGGGG + Intergenic
1152921521 17:83068582-83068604 GTCCCGGGAGGCGACAGCGGCGG + Intergenic
1152921534 17:83068616-83068638 GTCCCGGGAGGCGACAGCGGGGG + Intergenic
1152921547 17:83068650-83068672 GTCCCGGGAGGCGACAGCGGGGG + Intergenic
1152921561 17:83068684-83068706 GTCCCGGGAGGCGACAGCGGGGG + Intergenic
1152921575 17:83068719-83068741 GTCCCGGGAGGCGACAGCGGGGG + Intergenic
1152921589 17:83068754-83068776 GTCCCGGGAGGCGACAGCGGGGG + Intergenic
1152921603 17:83068789-83068811 GTCCCGGGAGGCGACAGCGGGGG + Intergenic
1152921616 17:83068823-83068845 GTCCCGGGAGGCGACAGCGGGGG + Intergenic
1152921631 17:83068858-83068880 GTCCCGGGAGGCGACAGCGGGGG + Intergenic
1153015642 18:580328-580350 GTCCCGCGCCGCGCCGGCGGGGG + Intergenic
1153040815 18:812013-812035 AACCGCGGCGGCGGCGGCGGCGG + Intronic
1153238882 18:3013218-3013240 TTCCAAGGCAGCGGCGGCTGCGG - Intronic
1153563773 18:6398740-6398762 TTGCGGGGGGGCGGGGGCGGGGG + Intronic
1153565607 18:6414726-6414748 ACCCCGCGCGGCGGCGGCCGTGG + Intronic
1153900611 18:9614498-9614520 TCCCCGGGCGGCCGCGGAGGAGG - Exonic
1154268213 18:12897119-12897141 TGCCGCGGCGGCGGCGGCGGCGG - Intronic
1154954781 18:21242788-21242810 TCCCCCGGCGGAGGCGGCGAGGG + Intronic
1155007505 18:21741523-21741545 CCCCCCGGCGGCAGCGGCGGCGG + Exonic
1155654572 18:28178002-28178024 GGCGAGGGCGGCGGCGGCGGCGG - Intergenic
1156063769 18:33115659-33115681 TAGCAGGGCGGCGGCGGGGGAGG - Intronic
1156099674 18:33578489-33578511 CGCGCGGGCGGTGGCGGCGGCGG - Intergenic
1156213837 18:34976941-34976963 TCCCGGAGCGGCGGCGGCGGCGG + Intronic
1156275827 18:35581835-35581857 TAGGCGCGCGGCGGCGGCGGCGG - Intronic
1157279119 18:46334243-46334265 TCGCGCGGCGGCGGCGGCGGCGG - Exonic
1157279121 18:46334246-46334268 TCCTCGCGCGGCGGCGGCGGCGG - Exonic
1157383934 18:47247073-47247095 GGCGGGGGCGGCGGCGGCGGCGG + Intronic
1157464312 18:47930841-47930863 TACCCGCGCGGCCGCGGCGGCGG - Intronic
1157614009 18:48976178-48976200 GAGCGGGGCGGCGGCGGCGGCGG + Intergenic
1157867050 18:51196765-51196787 GGCCGCGGCGGCGGCGGCGGGGG - Exonic
1157867059 18:51196780-51196802 TGCCCGGGAGGCGGCGGCCGCGG - Exonic
1158457803 18:57622872-57622894 TCCCCGGGCTGCGATGGCGGTGG + Intergenic
1158601941 18:58863509-58863531 GGGCCGGGCGGCGGCGGCGGCGG - Intronic
1158602113 18:58864069-58864091 TGCCCGGCCGGCGCCGGCGGGGG - Intronic
1158954143 18:62523557-62523579 CCCGCGGGCGGCGGCGGCGGCGG - Exonic
1158954160 18:62523599-62523621 CCCCGGGGCGGCGGCGGCGGCGG - Exonic
1158976693 18:62716438-62716460 CTCCCGGGCGGCGGCGGCTCCGG - Exonic
1159021232 18:63144872-63144894 GCCCAGGGCGGCGGGGGCGGGGG - Intronic
1159040575 18:63320029-63320051 TTCGCTGGCAGCGGCGGCGGCGG + Exonic
1160453338 18:78979741-78979763 CCGCCCGGCGGCGGCGGCGGGGG + Intergenic
1160594510 18:79964585-79964607 TTCCAGGGCGGAGGCGGGGCCGG - Exonic
1160680318 19:409109-409131 GATGCGGGCGGCGGCGGCGGCGG + Exonic
1160715007 19:572578-572600 GCCGCGGGCGGCGGCGGCAGCGG + Exonic
1160719128 19:589888-589910 GCTCCGGCCGGCGGCGGCGGCGG + Exonic
1160719167 19:590012-590034 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1160719181 19:590051-590073 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1160725377 19:615947-615969 TGCGGCGGCGGCGGCGGCGGCGG - Exonic
1160745379 19:708933-708955 TGTCCGGGCGGCGGCGGGCGCGG - Intergenic
1160790463 19:920586-920608 GTCCGGGCCGGCGGGGGCGGCGG - Exonic
1160873101 19:1285886-1285908 CTCCCCGGCGGGTGCGGCGGCGG + Intergenic
1160873167 19:1286077-1286099 CGCCCGCTCGGCGGCGGCGGCGG + Intergenic
1160873171 19:1286083-1286105 CTCGGCGGCGGCGGCGGCGGCGG + Intergenic
1160894290 19:1395491-1395513 GGCTCCGGCGGCGGCGGCGGCGG - Exonic
1160930462 19:1567637-1567659 GGCCGGGGCGGCGGCGGCGGCGG + Exonic
1160930589 19:1568000-1568022 GGCGGGGGCGGCGGCGGCGGCGG - Exonic
1160947754 19:1651659-1651681 TTCCCGGGGGGAGGCGGCCCGGG + Intronic
1160967694 19:1753819-1753841 CTGCTGGACGGCGGCGGCGGCGG + Exonic
1161022139 19:2015536-2015558 CCCAGGGGCGGCGGCGGCGGCGG + Exonic
1161080596 19:2308162-2308184 AGCCCGGGAGGCGGCGGCGGCGG - Intronic
1161400704 19:4065460-4065482 GGCCCCGGCGGCGGCGGTGGCGG + Intronic
1161577792 19:5064452-5064474 TTCCTCGGCGGCGGGGGTGGGGG + Intronic
1161628763 19:5340882-5340904 CGACCCGGCGGCGGCGGCGGCGG - Intergenic
1161779183 19:6279831-6279853 TTGAGCGGCGGCGGCGGCGGCGG - Exonic
1161779197 19:6279890-6279912 ATCGGCGGCGGCGGCGGCGGCGG - Exonic
1162013175 19:7830261-7830283 GTCCCGGGGGGCGGCTGAGGGGG + Intronic
1162021159 19:7869235-7869257 GCCGCGGGCGGCAGCGGCGGGGG - Exonic
1162030903 19:7916867-7916889 CTCCCCGGAGGCGGCGGCAGCGG - Exonic
1162033202 19:7926047-7926069 CTCCCCGGCGGCGGCGGCGGCGG + Exonic
1162430441 19:10625369-10625391 TTCCCGGGTGGGGGCGGGGAAGG + Exonic
1162535844 19:11262483-11262505 GAACCGGGAGGCGGCGGCGGCGG - Intergenic
1162751760 19:12833854-12833876 GACCGCGGCGGCGGCGGCGGCGG - Intronic
1162799723 19:13103810-13103832 TTCCTGGGCGGGGGGGGGGGGGG - Intergenic
1162861096 19:13506282-13506304 ATCAGCGGCGGCGGCGGCGGCGG - Intronic
1162954503 19:14090784-14090806 CGCGCGTGCGGCGGCGGCGGCGG - Intronic
1162959494 19:14117623-14117645 GCGCTGGGCGGCGGCGGCGGCGG + Exonic
1163138815 19:15332515-15332537 TGCGCTGGCGGCGGCGGCGGCGG - Intronic
1163138825 19:15332569-15332591 ACACCGGGCGGCGGCGGCGCGGG - Intergenic
1163146152 19:15380234-15380256 TCCTCTGGGGGCGGCGGCGGTGG + Exonic
1163154472 19:15432490-15432512 TCCCGCGGCGGCGGTGGCGGTGG + Intronic
1163547408 19:17948319-17948341 TGCGCGGGCGGCGGCGGCCTCGG + Intergenic
1163606977 19:18280981-18281003 CCCCCCGGCGGCGGCGGCGGCGG + Exonic
1163655677 19:18543539-18543561 TTCCCGAGGCGCGGCGGCCGCGG - Exonic
1163662996 19:18589559-18589581 CTCCCGCGAGGCGGCGGCGAAGG - Exonic
1163708620 19:18832366-18832388 GGCCCGGGCGGTGGCGGCGCGGG + Exonic
1163743892 19:19033489-19033511 GCCTCGCGCGGCGGCGGCGGCGG - Intronic
1163807250 19:19406448-19406470 CCCCGCGGCGGCGGCGGCGGCGG + Intronic
1164693591 19:30227747-30227769 TTGCACAGCGGCGGCGGCGGCGG - Intergenic
1165080046 19:33301843-33301865 TGCGAGGGCGGCGGCGGCGGCGG + Exonic
1165080114 19:33302104-33302126 CCCACGGGCGGCGGCGGCGGCGG - Exonic
1165242987 19:34482060-34482082 CTCCCGGTCGGGGGCGGCGGGGG + Exonic
1165311215 19:35030448-35030470 TGCAGCGGCGGCGGCGGCGGCGG - Intergenic
1165349522 19:35268522-35268544 CGCGCGCGCGGCGGCGGCGGCGG - Intergenic
1165349721 19:35269145-35269167 TTACCTGGCGGCGGCAGCAGCGG - Exonic
1165493910 19:36141033-36141055 TTGAAGGGCGGCGGCGGCGGCGG + Exonic
1165493944 19:36141117-36141139 GCCGGGGGCGGCGGCGGCGGCGG + Exonic
1165510970 19:36266527-36266549 GACCGGGGCGGCGGTGGCGGCGG - Intergenic
1165850859 19:38849701-38849723 GCGGCGGGCGGCGGCGGCGGTGG - Exonic
1165928641 19:39342540-39342562 GGCCCGAGCGGCGGCGGTGGCGG + Exonic
1166078102 19:40425623-40425645 TCCCGAAGCGGCGGCGGCGGGGG + Intronic
1166210346 19:41302826-41302848 TTCCGGGGCCGCGGGGGTGGTGG + Exonic
1166317983 19:41999209-41999231 CGCCCGGGCGTCGGCGCCGGCGG + Exonic
1166361255 19:42253870-42253892 TCCCCCGGCGGCGGCGGCGGCGG - Intronic
1166366568 19:42281115-42281137 ACCCCGGGCGGCGTCGGCGACGG - Intronic
1166802814 19:45468693-45468715 TACCTGGGAGGCGGCGGCGGTGG - Exonic
1166807695 19:45496979-45497001 CACCAGGGCGGCGGCGGCGGCGG - Exonic
1166820772 19:45578408-45578430 TTCCTGGGTGGCGGTGGGGGAGG - Intronic
1166888058 19:45973452-45973474 TGCGGCGGCGGCGGCGGCGGGGG + Exonic
1166888256 19:45973956-45973978 GGCGCGGGCGGCGGCGGCGACGG + Intergenic
1167072953 19:47231148-47231170 GCGCCTGGCGGCGGCGGCGGCGG - Intronic
1167112696 19:47471564-47471586 TTCTCGGGCGGCTGGGGAGGGGG - Intronic
1167310602 19:48735492-48735514 CTCCCGGGCGGCGTCGGGTGGGG - Exonic
1167311370 19:48739580-48739602 TCCACGTGCGGCGGGGGCGGAGG + Exonic
1167369600 19:49072669-49072691 GGCTGGGGCGGCGGCGGCGGCGG - Exonic
1167369656 19:49072836-49072858 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1167463827 19:49639977-49639999 GTCGTGGGCGGCGGCGGCGTGGG - Exonic
1167557474 19:50205308-50205330 TGCCAGGTGGGCGGCGGCGGCGG - Intronic
1167578329 19:50328316-50328338 GACGCGGGCGGCGGCGCCGGGGG - Exonic
1167578503 19:50328994-50329016 GACTCGGGCGGCTGCGGCGGTGG + Exonic
1167638583 19:50668379-50668401 CCCACGGGAGGCGGCGGCGGCGG - Exonic
1167648947 19:50719426-50719448 GTCCCGGTCGGCGGCGCCCGCGG + Intronic
1167649081 19:50719734-50719756 GGAGCGGGCGGCGGCGGCGGCGG - Intergenic
1167738687 19:51311716-51311738 GGCCCGGGGGGCGGCGGGGGCGG - Intergenic
1168064055 19:53909421-53909443 GACCCCGGTGGCGGCGGCGGCGG + Exonic
1168145967 19:54420388-54420410 TTCCCAGGCTGCGGGGGCTGGGG - Intronic
1168247007 19:55117495-55117517 TGGCCCGGGGGCGGCGGCGGCGG - Exonic
1168332387 19:55578165-55578187 TTCAGGGGCGGCGGGGGCGGTGG + Exonic
1168694410 19:58396567-58396589 GGCCCGGGCGGGGGCGGCGGCGG - Exonic
1202681421 1_KI270712v1_random:7110-7132 AGCCGGGGCGGCGGCGGCGGAGG + Intergenic
1202712352 1_KI270714v1_random:25349-25371 GGCAGGGGCGGCGGCGGCGGCGG + Intergenic
925609789 2:5693142-5693164 AGCGCGGCCGGCGGCGGCGGCGG + Exonic
925609845 2:5693340-5693362 GGCTCGGGCGGCGGCGGCGCGGG + Exonic
926090027 2:10043623-10043645 GCTGCGGGCGGCGGCGGCGGCGG - Exonic
926154899 2:10448288-10448310 GCGGCGGGCGGCGGCGGCGGCGG + Exonic
927070107 2:19519579-19519601 TTGCGGGGGGGCGGCGGTGGGGG - Intergenic
927215826 2:20667354-20667376 AGCCCAGGGGGCGGCGGCGGCGG + Exonic
927472317 2:23385557-23385579 CTGCCGGGAGGCGGCGGCGGCGG + Exonic
927713820 2:25340917-25340939 TGCCCGGGCGGCCGCGGTGGCGG - Intronic
927881456 2:26692707-26692729 CTCCGCGGCGGCGGCGGCGGCGG + Intronic
928549517 2:32357284-32357306 CTCCTCGGCGGCGGGGGCGGGGG + Exonic
928606358 2:32947622-32947644 TCCGGCGGCGGCGGCGGCGGCGG - Exonic
928606359 2:32947625-32947647 GGCTCCGGCGGCGGCGGCGGCGG - Exonic
928904527 2:36355959-36355981 TTCTGGCGCGGCGGCGGCGGTGG - Exonic
928983222 2:37156925-37156947 TCTCCGGCCGGCGGCGGCGGCGG - Exonic
929133503 2:38602163-38602185 TCGCGGCGCGGCGGCGGCGGCGG - Intronic
929174234 2:38960557-38960579 GCCGCGGGCGGCGACGGCGGCGG - Exonic
929188788 2:39120987-39121009 TACACCGGCGGCGGCGGTGGCGG - Exonic
930011418 2:46941032-46941054 CTCCGCGGCGGGGGCGGCGGCGG + Intronic
930136107 2:47905608-47905630 TGCTGGGGCGGCTGCGGCGGCGG + Exonic
930358224 2:50346885-50346907 CCCGGGGGCGGCGGCGGCGGCGG - Intronic
930358226 2:50346888-50346910 TCGCCCGGGGGCGGCGGCGGCGG - Intronic
930700832 2:54456687-54456709 AGCCCGGGCGGGGGCGGCGCGGG + Intronic
931253508 2:60552420-60552442 TTCGGCGGCGGCGGCGGCGGCGG + Intronic
931253669 2:60553281-60553303 GGGGCGGGCGGCGGCGGCGGCGG + Exonic
931254112 2:60555288-60555310 CTCCCCGGCGGCGGCGGCGGCGG - Intergenic
931517804 2:63059859-63059881 TGCCGGGCCGGGGGCGGCGGGGG + Intergenic
931602530 2:64019024-64019046 GCGCCGGGCGGCGGCGGCCGTGG - Exonic
931801475 2:65762288-65762310 TTCCAGGGCAGCGGGGGAGGAGG + Intergenic
932231500 2:70087559-70087581 GGGGCGGGCGGCGGCGGCGGAGG - Exonic
932593705 2:73081474-73081496 TTCAGGGGCGGCGGTGGTGGCGG + Intronic
932699847 2:73985056-73985078 GCCCCAGGCGGCGGCGGCGGCGG + Intergenic
933560176 2:83877780-83877802 TTCCCGAGAGGAGGCGGCTGAGG - Intergenic
933666862 2:84971285-84971307 TCCCGCGGCGGCGGCGGCGGCGG - Exonic
933684713 2:85133700-85133722 GGCGGGGGCGGCGGCGGCGGCGG + Exonic
933907959 2:86914013-86914035 TGGCCGGGCGGCGGCGGCGGCGG + Intronic
933907984 2:86914077-86914099 TGGCCGGGCGGCGGCGGCGGCGG + Intronic
933908004 2:86914126-86914148 TGGCCGGGCGGCGGCGGCGGCGG + Intronic
933908043 2:86914231-86914253 TGGCCGGGCGGCGGCGGCGGCGG + Intronic
933908060 2:86914278-86914300 CGGCCGGGCGGCGGCGGCGGCGG + Intronic
933908078 2:86914327-86914349 TGGCCGGGCGGCGGCGGCGGCGG + Intronic
933908094 2:86914373-86914395 TGGCCGGGCGGCGGCGGCGGCGG + Intronic
933908108 2:86914413-86914435 TGGCCGGGCGGCGGCGGCGGCGG + Intronic
933908134 2:86914489-86914511 TGGCCGGGCTGCGGCGGCGGCGG + Intronic
933908138 2:86914498-86914520 TGCGGCGGCGGCGGCGGCGGCGG + Intronic
933908152 2:86914538-86914560 TGGCCGGGCGGCGGCGGCGGCGG + Intronic
933908175 2:86914605-86914627 TGGCCGGGCGGCGGCGGCGGCGG + Intronic
933908187 2:86914639-86914661 TGGCCGGGCGGCGGCGGCGGCGG + Intronic
933908200 2:86914676-86914698 TGGCCGGGCGGCGGCGGCGGCGG + Intronic
933908214 2:86914716-86914738 TGGCCGGGCGGCGGCGGCGGCGG + Intronic
933908230 2:86914762-86914784 TGGCCGGGCGGCGGCGGCGGCGG + Intronic
933908242 2:86914793-86914815 TGGACGGGCGGCGGCGGCGGCGG + Intronic
933908258 2:86914842-86914864 TGGCCGGGCGGCGGCGGCGGCGG + Intronic
933908276 2:86914894-86914916 TGGCCGGGCGGCGGCGGAGGCGG + Intronic
933908288 2:86914928-86914950 TGGCCGGGCGGCGGCGGCGGCGG + Intronic
934011434 2:87824753-87824775 TGGCCGGGCGGCGGCGGCGGCGG - Intronic
934011450 2:87824796-87824818 TGGCCGGGCGGCGGCGGCGGCGG - Intronic
934011462 2:87824827-87824849 TGGCCGGGCGGCGGCGGCGGCGG - Intronic
934011476 2:87824867-87824889 TGCGGCGGCGGCGGCGGCGGCGG - Intronic
934011478 2:87824873-87824895 TTAATGTGCGGCGGCGGCGGCGG - Intronic
934011550 2:87825381-87825403 TGGCCGGGCGGCGGCGGCGGCGG - Intronic
934011567 2:87825427-87825449 TGGCCGGGCGGCGGCGGCGGCGG - Intronic
934079050 2:88452276-88452298 GCCCCGGGGGGCGGCGGCGGCGG + Exonic
934079112 2:88452452-88452474 GCCCGGGGCGGCGGCGGTGGCGG + Exonic
934248014 2:90324086-90324108 AGCCGCGGCGGCGGCGGCGGCGG + Intergenic
934248168 2:90324630-90324652 AGCCGCGGCGGCGGCGGCGGCGG + Intergenic
934248183 2:90324691-90324713 CGCCGCGGCGGCGGCGGCGGCGG + Intergenic
934248357 2:90325304-90325326 CGCCGCGGCGGCGGCGGCGGCGG + Intergenic
934248368 2:90325342-90325364 CGCCGCGGCGGCGGCGGCGGCGG + Intergenic
934248379 2:90325380-90325402 CGCCGCGGCGGCGGCGGCGGCGG + Intergenic
934248395 2:90325444-90325466 CGCCGCGGCGGCGGCGGCGGCGG + Intergenic
934261194 2:91478107-91478129 CACCGGGGCGGCGGCGGCGGCGG - Intergenic
934296818 2:91749024-91749046 TGGCCGGGCCGCGGCGGCGGCGG - Intergenic
934304466 2:91809924-91809946 AGCCGCGGCGGCGGCGGCGGCGG - Intergenic
934328791 2:92042826-92042848 AGCCGCGGCGGCGGCGGCGGCGG + Intergenic
934638350 2:96010714-96010736 CTACCTGGCGGCGGCGGCGGCGG - Intergenic
934678252 2:96265334-96265356 TGCCCGGCGGGCGCCGGCGGAGG - Exonic
934783297 2:96986541-96986563 TCCCCAGCTGGCGGCGGCGGCGG - Exonic
934795305 2:97094697-97094719 CTACCTGGCGGCGGCGGCGGCGG + Exonic
935112319 2:100104806-100104828 CACCGCGGCGGCGGCGGCGGCGG - Intronic
935137715 2:100322053-100322075 CACTGGGGCGGCGGCGGCGGCGG + Exonic
935149079 2:100417538-100417560 GTCCCGGGATGTGGCGGCGGCGG + Exonic
935196645 2:100820243-100820265 AGCCGCGGCGGCGGCGGCGGCGG + Exonic
935301540 2:101697659-101697681 AACCCGGGAGGCGGAGGCGGAGG - Intronic
935592440 2:104855290-104855312 GGCCGCGGCGGCGGCGGCGGCGG + Intergenic
935592510 2:104855456-104855478 TGCTGCGGCGGCGGCGGCGGTGG + Intergenic
935592698 2:104856103-104856125 GTGCGCGGCGGCGGCGGCGGCGG - Exonic
935592734 2:104856225-104856247 GGGCCCGGCGGCGGCGGCGGCGG + Exonic
935592781 2:104856387-104856409 CACCACGGCGGCGGCGGCGGCGG + Exonic
935592884 2:104857038-104857060 TGCGGAGGCGGCGGCGGCGGCGG - Exonic
936122683 2:109760395-109760417 GGCGGGGGCGGCGGCGGCGGCGG + Intergenic
936122698 2:109760436-109760458 GCCGGGGGCGGCGGCGGCGGCGG + Intergenic
936126696 2:109794576-109794598 CGGCCGGGGGGCGGCGGCGGCGG + Intronic
936221932 2:110610803-110610825 TTCGGCGGCGGCGGCGGCAGCGG - Intergenic
936222010 2:110611078-110611100 GGCGGGGGCGGCGGCGGCGGCGG - Intergenic
938018394 2:127885990-127886012 CGGCGGGGCGGCGGCGGCGGCGG + Intergenic
938091798 2:128439410-128439432 TACCCGGGAGGCAGCAGCGGAGG - Intergenic
938365082 2:130727805-130727827 TCCCCGGGCTGCGGCGGACGTGG + Intergenic
938406244 2:131034875-131034897 GGCGGGGGCGGCGGCGGCGGCGG - Intronic
938406246 2:131034881-131034903 TGTGCGGGCGGGGGCGGCGGCGG - Intronic
938422244 2:131154798-131154820 CTCCCGGGCGCCGGTGGAGGAGG + Intronic
938451544 2:131425332-131425354 TCGGCAGGCGGCGGCGGCGGCGG - Intergenic
938745687 2:134276158-134276180 TTGGCGGGCGGCGGGGGTGGGGG - Intronic
939184736 2:138846960-138846982 TTCCCGGTTGGCGGGGGGGGAGG - Intergenic
939432656 2:142130781-142130803 CGGCCCGGCGGCGGCGGCGGCGG + Exonic
939629635 2:144516844-144516866 TCCCGGGGCGGGGGCGGGGGTGG - Intronic
939629761 2:144517174-144517196 AACCGAGGCGGCGGCGGCGGCGG - Intronic
939969516 2:148644451-148644473 TGACCGGGCGGCGGCGGGAGAGG + Intronic
940639951 2:156334464-156334486 TCGCCGAGCAGCGGCGGCGGCGG - Intronic
941020852 2:160407272-160407294 GGCCCGGGCGGCGGCGGCGAGGG + Intronic
941119113 2:161507857-161507879 GCCCGCGGCGGCGGCGGCGGCGG - Intronic
941951494 2:171160833-171160855 CGCCCGGGAGGCGGCGGCGGCGG + Exonic
942046517 2:172102300-172102322 CCGGCGGGCGGCGGCGGCGGCGG - Exonic
942046520 2:172102303-172102325 CACCCGGCGGGCGGCGGCGGCGG - Exonic
942046554 2:172102432-172102454 CCCCCGAGCGGCGGCGGCGCCGG - Exonic
942241113 2:173964680-173964702 CCCCCCGGCGGCGGCGGCGGCGG + Intronic
942278192 2:174337441-174337463 CGCCCGGGCGGCGGCAGCGGCGG + Exonic
942346216 2:175005258-175005280 CGCACTGGCGGCGGCGGCGGCGG + Intronic
942446160 2:176080285-176080307 TCCCGGGGTGGCGGTGGCGGCGG - Exonic
942448392 2:176093049-176093071 TTCGGGGCGGGCGGCGGCGGCGG + Exonic
942450898 2:176107578-176107600 TACCGCGGCGGCGGCGGCGGCGG + Exonic
942450918 2:176107629-176107651 GGCCCCGGCGGGGGCGGCGGCGG + Exonic
942450934 2:176107673-176107695 CTACGCGGCGGCGGCGGCGGCGG + Exonic
942453585 2:176123144-176123166 TTCCCGGGCGGTGCGGGCGGTGG + Exonic
942890491 2:180981009-180981031 GGCCGGGGCGGCGGCGGCGGTGG + Intronic
943571508 2:189580773-189580795 GCCCACGGCGGCGGCGGCGGCGG - Exonic
943669861 2:190649078-190649100 CGCGCGGGCGGCGGCGGCGGCGG - Intronic
943725327 2:191246090-191246112 TGCCCCGGCGGCGGCGGGGGAGG + Intronic
944221765 2:197310555-197310577 GTAGCGGGCGGCGGCGCCGGCGG - Intronic
944556005 2:200888601-200888623 AACCCGGGAGGCGGAGGCGGAGG - Intronic
944675845 2:202033870-202033892 CTCCCGGCGGGCGGCGGCGGCGG + Intergenic
944675848 2:202033873-202033895 CCGGCGGGCGGCGGCGGCGGCGG + Intergenic
944715907 2:202376184-202376206 AGAGCGGGCGGCGGCGGCGGCGG - Intergenic
944743684 2:202635413-202635435 CCCGCAGGCGGCGGCGGCGGCGG + Exonic
944831217 2:203535340-203535362 CCCCGCGGCGGCGGCGGCGGCGG + Exonic
945466018 2:210171324-210171346 AACCGCGGCGGCGGCGGCGGCGG - Exonic
946325332 2:218981913-218981935 GTCCTGGGCGGCCGCGGCGGCGG + Exonic
946354875 2:219178326-219178348 GGCTCGGGCGGCGGCTGCGGCGG + Exonic
946431018 2:219627523-219627545 CGGCCCGGCGGCGGCGGCGGCGG + Intronic
946692397 2:222319458-222319480 TCCTCGGCAGGCGGCGGCGGCGG + Intergenic
946692399 2:222319461-222319483 TCGGCAGGCGGCGGCGGCGGCGG + Intergenic
946865609 2:224039112-224039134 TCCCCAGGGGGCGGCCGCGGAGG + Intronic
946921434 2:224585171-224585193 GGCGGGGGCGGCGGCGGCGGCGG + Exonic
947353643 2:229271346-229271368 GGTCCGGGCGGCGGCGGCGGGGG - Intergenic
947506746 2:230713328-230713350 TTCCTGGGTGGCGGCGGCCCCGG + Intronic
947549784 2:231037838-231037860 GGCGGGGGCGGCGGCGGCGGCGG + Exonic
947566676 2:231198630-231198652 TGCCCGGGTGACGGCTGCGGAGG + Exonic
947860530 2:233354564-233354586 TCCTCGGGCGGCGGCGGCGGAGG - Exonic
948116037 2:235494634-235494656 GCGCGGGGCGGCGGCGGCGGGGG + Exonic
948207006 2:236167778-236167800 AGCGCGGGCGGCGGCGGCGGCGG + Exonic
948438129 2:237967397-237967419 GACCGCGGCGGCGGCGGCGGGGG + Intronic
948492139 2:238320556-238320578 GGACCGGGCGGCGGCGGCGGCGG + Exonic
948645368 2:239400847-239400869 TGTTCGGGCGGCGGCGGCGGCGG + Exonic
948805774 2:240453027-240453049 TTCCAGCGCGGCGGCGGACGCGG - Intronic
948824683 2:240568506-240568528 GCGCCGGGCGGCGGCGGCGGCGG - Intronic
948991761 2:241559161-241559183 TGCGTGGGCGGCGGGGGCGGAGG - Intronic
949000478 2:241610265-241610287 TTCCGGGGCGGGGCCGGCGGAGG - Intronic
1168757401 20:326562-326584 TGTCGGGGAGGCGGCGGCGGCGG - Exonic
1168777858 20:462589-462611 CGCCCGGCCGGCGGCGGGGGAGG + Intergenic
1169065559 20:2692795-2692817 TCCCCCGGGAGCGGCGGCGGCGG + Intergenic
1169171829 20:3471353-3471375 GGCCGCGGCGGCGGCGGCGGCGG + Exonic
1169800339 20:9507091-9507113 AGCCCAGGCGGCGGAGGCGGCGG - Intergenic
1170150419 20:13221468-13221490 CTGCCTGGCGGCGGCGGCGGCGG - Intergenic
1170150450 20:13221552-13221574 TGCGGCGGCGGCGGCGGCGGCGG + Intergenic
1170617805 20:17968483-17968505 CGCCCAGGCGGCGGCGGCGGCGG - Intronic
1170674522 20:18467008-18467030 AACCCGGGCGGCGGCGAAGGAGG - Exonic
1170756917 20:19212878-19212900 TCCGGCGGCGGCGGCGGCGGCGG - Exonic
1170756919 20:19212881-19212903 CCCTCCGGCGGCGGCGGCGGCGG - Exonic
1171499832 20:25585176-25585198 TTTCCCGACGGCGGCGGCGCGGG - Intronic
1172073666 20:32277728-32277750 AAAGCGGGCGGCGGCGGCGGCGG - Exonic
1172083222 20:32358683-32358705 GGCTGGGGCGGCGGCGGCGGTGG - Exonic
1172117979 20:32583313-32583335 GGCCCGGGCGGCCGCGGAGGGGG + Intronic
1172143955 20:32743417-32743439 GAGCAGGGCGGCGGCGGCGGTGG - Exonic
1172331162 20:34077054-34077076 GGCGCCGGCGGCGGCGGCGGTGG + Exonic
1172474459 20:35226678-35226700 GGCCGAGGCGGCGGCGGCGGCGG + Exonic
1172474494 20:35226781-35226803 TGGCCCGGCGGCGGCGGCGGCGG - Exonic
1172474529 20:35226885-35226907 CGCGCGGGCGGCGGCGGCGGCGG + Exonic
1172951217 20:38724502-38724524 TGGCGGAGCGGCGGCGGCGGCGG - Exonic
1173243399 20:41317505-41317527 TCACCTGGCAGCGGCGGCGGTGG + Intronic
1173454157 20:43189990-43190012 CGGGCGGGCGGCGGCGGCGGCGG - Intergenic
1173672874 20:44810296-44810318 GGCCGCGGCGGCGGCGGCGGCGG + Intronic
1174287768 20:49484193-49484215 TGCTCCCGCGGCGGCGGCGGCGG + Intergenic
1174287769 20:49484196-49484218 TCCCGCGGCGGCGGCGGCGGCGG + Intergenic
1174317464 20:49713763-49713785 GGCCCAGGCGGTGGCGGCGGCGG - Exonic
1174330406 20:49812962-49812984 TTCCCGGGCGGCGGAGGCGGCGG + Intronic
1174386666 20:50191526-50191548 TCGGCGGGCGGCGGCGGCGGCGG - Exonic
1174494666 20:50931108-50931130 TTCACCGGCGCGGGCGGCGGCGG + Exonic
1175267059 20:57709532-57709554 CTGCCCGGCGGCGGCGGCGGCGG + Exonic
1175338105 20:58209660-58209682 TTCCCCGGTGGGGGCGGGGGCGG - Intergenic
1175429527 20:58891680-58891702 CGGCCGGGCTGCGGCGGCGGCGG - Intronic
1175429539 20:58891710-58891732 GCCCATGGCGGCGGCGGCGGCGG - Intronic
1175712853 20:61235011-61235033 TTCAGGGGTGACGGCGGCGGGGG - Intergenic
1175715513 20:61252441-61252463 CTCGGCGGCGGCGGCGGCGGCGG + Exonic
1175847372 20:62065827-62065849 GGCCCGAGCGGCGGCGGCGGCGG - Intergenic
1175856276 20:62122539-62122561 CGCCCAGGCGGAGGCGGCGGCGG + Exonic
1175951930 20:62588172-62588194 TTCCCGGGCGGCGACTGACGTGG + Intergenic
1176157032 20:63627064-63627086 TTCGGCGGCGGCGGCGGCGCGGG + Intergenic
1176207111 20:63895199-63895221 ACCCCGGGCGGCGGCGGCGGCGG - Exonic
1176283317 20:64327697-64327719 TTCCTGGGCCCTGGCGGCGGCGG + Intergenic
1176549393 21:8214729-8214751 GGTCGGGGCGGCGGCGGCGGTGG + Intergenic
1176549732 21:8216028-8216050 TCGGAGGGCGGCGGCGGCGGCGG + Intergenic
1176550164 21:8217357-8217379 TCGGCGCGCGGCGGCGGCGGCGG + Intergenic
1176557286 21:8258952-8258974 GGTCGGGGCGGCGGCGGCGGCGG + Intergenic
1176557623 21:8260257-8260279 TCGGAGGGCGGCGGCGGCGGCGG + Intergenic
1176568321 21:8397763-8397785 GGTCGGGGCGGCGGCGGCGGTGG + Intergenic
1176568657 21:8399062-8399084 TCGGAGGGCGGCGGCGGCGGCGG + Intergenic
1176569092 21:8400392-8400414 TCGGCGCGCGGCGGCGGCGGCGG + Intergenic
1176576228 21:8441987-8442009 GGTCGGGGCGGCGGCGGCGGCGG + Intergenic
1176576568 21:8443291-8443313 TCGGAGGGCGGCGGCGGCGGCGG + Intergenic
1176577006 21:8444627-8444649 TCGGCGCGCGGCGGCGGCGGCGG + Intergenic
1176952665 21:15064957-15064979 AACTCGGGAGGCGGCGGCGGAGG - Exonic
1177011055 21:15730368-15730390 CCCCGCGGCGGCGGCGGCGGCGG - Exonic
1177011058 21:15730371-15730393 GGCCCCCGCGGCGGCGGCGGCGG - Exonic
1177834085 21:26170695-26170717 GCCCCGGGAGACGGCGGCGGTGG - Intronic
1178334666 21:31732273-31732295 TTTCCCGCCGGCGGCGGCGGCGG + Intergenic
1178493851 21:33070946-33070968 CTCCCCGGCGGCGGCGCAGGCGG + Exonic
1178534967 21:33403593-33403615 TGGCGGGGCCGCGGCGGCGGCGG - Exonic
1179561593 21:42219238-42219260 CCCGGGGGCGGCGGCGGCGGCGG - Exonic
1179561596 21:42219241-42219263 TGCCCCGGGGGCGGCGGCGGCGG - Exonic
1179663571 21:42893595-42893617 GCCTCGGGCAGCGGCGGCGGCGG - Intronic
1179674911 21:42974755-42974777 GACCCGGGCGGCAGCGGCGGCGG - Intronic
1179786466 21:43733260-43733282 TTCCAGGGCGGGGGGGGCGGGGG - Intronic
1179836067 21:44034342-44034364 TTCCTGAGGGGCGGCGGGGGTGG - Intronic
1180014709 21:45074593-45074615 GGCCGTGGCGGCGGCGGCGGCGG + Intronic
1180462033 22:15573512-15573534 CTTTCGGGAGGCGGCGGCGGCGG - Intergenic
1180559226 22:16601979-16602001 AACCCGAGCAGCGGCGGCGGCGG + Intergenic
1180801451 22:18633947-18633969 ATCCCGGGCGCTGGCGGCGGTGG + Intergenic
1180852685 22:19029487-19029509 ATCCCGGGCGCTGGCGGCGGTGG + Intergenic
1180949413 22:19714464-19714486 GGAGCGGGCGGCGGCGGCGGCGG + Exonic
1180960667 22:19760997-19761019 TAGCGCGGCGGCGGCGGCGGGGG - Exonic
1180960691 22:19761057-19761079 TAGGCGTGCGGCGGCGGCGGCGG - Exonic
1180961936 22:19766182-19766204 TCTGCGGGCGGCGGCGGCGGCGG - Intronic
1181026855 22:20131827-20131849 ACCCGCGGCGGCGGCGGCGGCGG - Intronic
1181220270 22:21361314-21361336 ATCCCGGGCGCTGGCGGCGGTGG - Intergenic
1181478021 22:23180562-23180584 GTCCGAGGAGGCGGCGGCGGCGG + Exonic
1181478093 22:23180835-23180857 GGCCCGCGCGGCGGCGGCGGCGG - Exonic
1181725146 22:24806281-24806303 GTCCCAGGAGGCGGTGGCGGCGG - Intronic
1181793072 22:25282860-25282882 TCAGCTGGCGGCGGCGGCGGCGG + Intergenic
1181934618 22:26429606-26429628 GGCGGGGGCGGCGGCGGCGGCGG - Intronic
1181934621 22:26429612-26429634 ATCCTCGGCGGGGGCGGCGGCGG - Intronic
1182237000 22:28883805-28883827 GGCGCAGGCGGCGGCGGCGGCGG - Exonic
1182374724 22:29838208-29838230 GTCGGCGGCGGCGGCGGCGGCGG - Exonic
1182663978 22:31944326-31944348 AGGCCGGGCGGCGGCGGCGGCGG + Intronic
1182692899 22:32176161-32176183 TGGCGGAGCGGCGGCGGCGGCGG - Intergenic
1183247211 22:36703229-36703251 TGCCCGGGCAGCGGCGGCGGCGG + Exonic
1183466706 22:37983796-37983818 GGCCGAGGCGGCGGCGGCGGCGG - Exonic
1183671958 22:39278242-39278264 ATCCCGGGAGGCGGCGGCCGAGG - Intergenic
1183702295 22:39457426-39457448 ATCCCGGGCTCCGGCGGCAGCGG - Exonic
1184219321 22:43089240-43089262 TGCCCGGGAGGCGGCGGCCTGGG + Intronic
1184236652 22:43186789-43186811 CTCCCGGGCGGCGGGAGCCGCGG - Intronic
1184236737 22:43187101-43187123 ACGGCGGGCGGCGGCGGCGGTGG - Exonic
1184251098 22:43260794-43260816 TTCCCTGGCGGGGGCAGCTGGGG + Intronic
1184512015 22:44939493-44939515 TTCCCAGGTGGGGGCGGCAGAGG + Intronic
1184557413 22:45240847-45240869 TTGGCGGGTGGTGGCGGCGGCGG - Intergenic
1184767036 22:46577400-46577422 GGCCCGGGCGGCGGCGGCGGCGG - Intronic
1184927083 22:47650543-47650565 TTCCCAGGCAGAGGTGGCGGAGG - Intergenic
1185006609 22:48280706-48280728 TTCCCTGGGGGCGGCGATGGGGG - Intergenic
1185255055 22:49827365-49827387 TTTGGCGGCGGCGGCGGCGGCGG - Intronic
1185278855 22:49961378-49961400 GGCACGGGCGGCGGCGGCGGCGG + Intronic
1185294872 22:50048218-50048240 TTACCGGGTGGGGGCGGCTGGGG - Intronic
1185336177 22:50271781-50271803 TCCCCCGGCGGCCGCGGCCGCGG - Intergenic
1185374290 22:50474962-50474984 CTCCGCGGCGGCGGCGGCGGCGG + Exonic
1185384507 22:50525699-50525721 ATCCAGGGCTGCGGAGGCGGGGG - Intronic
1185384696 22:50526402-50526424 TGCCCGGGTGGCCGCGGCGCTGG - Exonic
1185398504 22:50604422-50604444 TCCCCGGGCGGGCGCGGCGCAGG - Exonic
1185409417 22:50674365-50674387 TTCCCCGGGGGCGGGGGCGGCGG - Intergenic
1185409438 22:50674437-50674459 CGCAGGGGCGGCGGCGGCGGCGG - Intergenic
1185413378 22:50697398-50697420 CTCCCGGGGGTCGGCGGCGAGGG + Intergenic
1203238468 22_KI270732v1_random:30915-30937 CGCCCCGGCGGCGGCGGCGGCGG - Intergenic
1203254278 22_KI270733v1_random:131045-131067 GGTCGGGGCGGCGGCGGCGGCGG + Intergenic
1203254618 22_KI270733v1_random:132349-132371 TCGGAGGGCGGCGGCGGCGGCGG + Intergenic
1203255057 22_KI270733v1_random:133689-133711 TCGGCGCGCGGCGGCGGCGGCGG + Intergenic
1203262334 22_KI270733v1_random:176124-176146 GGTCGGGGCGGCGGCGGCGGCGG + Intergenic
1203262674 22_KI270733v1_random:177428-177450 TCGGAGGGCGGCGGCGGCGGCGG + Intergenic
1203263113 22_KI270733v1_random:178768-178790 TCGGCGCGCGGCGGCGGCGGCGG + Intergenic
949970244 3:9397674-9397696 TCCCCCGGCAGCGGCGGCGGCGG - Intronic
950004483 3:9682939-9682961 TACTCGGGGGGCGGGGGCGGGGG - Intronic
950110715 3:10417055-10417077 TTCCCAGACGGCGGCGGGGGGGG + Intronic
950316310 3:12004654-12004676 GGACCGGGGGGCGGCGGCGGCGG - Exonic
950361694 3:12453832-12453854 TACCCGGGAGGCTGAGGCGGGGG + Intergenic
950729786 3:14947607-14947629 CGCGCGGGCGGCGGCGGCGGCGG + Intronic
950829412 3:15859590-15859612 CTCGGCGGCGGCGGCGGCGGCGG - Exonic
951080302 3:18444725-18444747 AGCTCCGGCGGCGGCGGCGGCGG - Intronic
951208322 3:19947262-19947284 AGCGCCGGCGGCGGCGGCGGCGG + Exonic
951611363 3:24495214-24495236 TTGCGCGGCGGTGGCGGCGGCGG + Intronic
951717360 3:25664170-25664192 TTCCGGGCCCGCGGCGGGGGCGG - Intronic
951717528 3:25664851-25664873 GACCGTGGCGGCGGCGGCGGCGG - Intronic
951907895 3:27721911-27721933 AGCCGCGGCGGCGGCGGCGGCGG + Exonic
951981972 3:28575981-28576003 CATCCCGGCGGCGGCGGCGGCGG - Intergenic
952241227 3:31532945-31532967 GCACCAGGCGGCGGCGGCGGAGG + Exonic
952382892 3:32818201-32818223 TCGTCGGGGGGCGGCGGCGGGGG + Exonic
953705143 3:45225512-45225534 CGCCCCGGCGGTGGCGGCGGCGG + Exonic
953947772 3:47164009-47164031 GACCGCGGCGGCGGCGGCGGCGG + Intergenic
953982169 3:47418399-47418421 GGCCCGGGCGGCGGAGGCGCGGG - Exonic
953989872 3:47475814-47475836 CTCCCAAGCTGCGGCGGCGGCGG + Exonic
954186252 3:48919088-48919110 CTCCCGGGCGACGGCGAAGGCGG - Exonic
954265932 3:49470357-49470379 TCCCCGGGGAGCGGCGGTGGCGG + Exonic
954615553 3:51967339-51967361 TCCTGCGGCGGCGGCGGCGGCGG + Exonic
954618606 3:51983295-51983317 TCCCCGGGCAGCGGCCGCCGCGG - Exonic
954632795 3:52056297-52056319 TTCGGGGGCGGCGGCGGCTGGGG - Exonic
954702044 3:52455609-52455631 GCGCCGGGCGGCGGTGGCGGCGG + Exonic
954778901 3:53045428-53045450 TGGCCGGGCGGCGGCAGTGGCGG - Intronic
955768561 3:62369041-62369063 GACCCAGGAGGCGGCGGCGGCGG + Intergenic
955769248 3:62372552-62372574 CTCCGGGCGGGCGGCGGCGGAGG - Exonic
955911538 3:63863794-63863816 GTGCGCGGCGGCGGCGGCGGCGG + Exonic
955911575 3:63863960-63863982 TCCCGCGGCGGCGGCGGCGGCGG - Intergenic
955916482 3:63912637-63912659 GCGCCGCGCGGCGGCGGCGGCGG + Exonic
956675020 3:71725281-71725303 CTCGGGGGCGGCGGCAGCGGCGG + Exonic
956678015 3:71753644-71753666 CTCCGCGGCGGCGGCGGCGGCGG + Intronic
956813595 3:72888210-72888232 GTGCGGCGCGGCGGCGGCGGCGG - Exonic
959026670 3:101247517-101247539 AACCCGGGCGGCGGAGGCTGTGG + Intronic
960602175 3:119469174-119469196 TTCCCGGGAGCCGGCCGCGCGGG - Intronic
960664216 3:120094379-120094401 GGCCCGGGCGGCGGCGGCGGCGG + Intronic
960925994 3:122795276-122795298 AAGCCGGGAGGCGGCGGCGGCGG + Exonic
961081617 3:124033201-124033223 TGCTGCGGCGGCGGCGGCGGCGG + Intergenic
961202442 3:125055679-125055701 TCCCGGGGCGGCGTGGGCGGCGG + Exonic
961646187 3:128393996-128394018 TTCCAGTGGGGCGGTGGCGGGGG + Intronic
961734665 3:128993915-128993937 GTCCCGGGCTGCGGCGGCCGAGG + Intronic
961827178 3:129605303-129605325 CACCCGGGCGGTGGCGGCGGCGG - Intronic
962277959 3:134030045-134030067 TGAGGGGGCGGCGGCGGCGGCGG - Exonic
962301892 3:134250657-134250679 CTCTTCGGCGGCGGCGGCGGCGG - Exonic
962678206 3:137771415-137771437 TTCCGGGGAGGCGGCGAGGGGGG + Intergenic
962726575 3:138234187-138234209 AACCCGGGAGGCGGAGGCGGAGG - Intronic
963038377 3:141051391-141051413 GGAGCGGGCGGCGGCGGCGGAGG + Exonic
963236738 3:142963696-142963718 TCCGGGGGCGGCGGCGGCGGAGG - Intergenic
963798752 3:149657263-149657285 TGCCCAGGCGGCGGGAGCGGAGG + Exonic
963827500 3:149970921-149970943 GTAGCGGGCGGCGGCGGCGCGGG + Exonic
963904459 3:150762665-150762687 ATCTCGGGCCCCGGCGGCGGCGG - Exonic
966182198 3:177197560-177197582 GCCCGCGGCGGCGGCGGCGGCGG + Intergenic
966449867 3:180045992-180046014 TTGGGGGGCGGCGGGGGCGGGGG + Intergenic
966866515 3:184261465-184261487 TGGGCAGGCGGCGGCGGCGGCGG + Intronic
966911424 3:184562260-184562282 AGCCCCGGCGGCGGCGACGGCGG - Exonic
967859680 3:194141536-194141558 GGAGCGGGCGGCGGCGGCGGCGG + Intergenic
967924183 3:194633375-194633397 CTCCCGGGCGCGGGCGGCGGCGG + Exonic
967924186 3:194633381-194633403 GGCGCGGGCGGCGGCGGCGAAGG + Exonic
967930430 3:194686784-194686806 CAGCTGGGCGGCGGCGGCGGCGG - Exonic
967930671 3:194688025-194688047 GTCCCCGGCGGTGGCGGAGGTGG - Exonic
968161744 3:196432404-196432426 TTGTTCGGCGGCGGCGGCGGCGG - Exonic
968193606 3:196689140-196689162 AACCCGGGAGGCGGAGGCGGAGG + Intronic
968382388 4:107738-107760 GGCCCGGGCGGCGGCGGCTCGGG + Intergenic
968613719 4:1568220-1568242 CACCAGGGCGGCGGGGGCGGAGG + Intergenic
968642496 4:1721591-1721613 CTTCCTGGCGGCGGCGGCGCGGG + Exonic
968659639 4:1793709-1793731 GCCCTGGGCGGCGGCGGCGGCGG + Intronic
968674712 4:1871344-1871366 GGCCCCGGCTGCGGCGGCGGCGG + Intergenic
968701301 4:2059402-2059424 ACCCGCGGCGGCGGCGGCGGCGG - Intergenic
968835790 4:2963575-2963597 TGCCCCGGCCGCGGCGGCGAGGG + Intergenic
968965149 4:3765926-3765948 GCGCAGGGCGGCGGCGGCGGCGG + Intergenic
969053020 4:4386260-4386282 TGCTCGGGCGGCGGCTGCAGTGG + Exonic
969413354 4:7043477-7043499 CTCGTGCGCGGCGGCGGCGGCGG + Exonic
969559811 4:7939774-7939796 TACACGGGCTGAGGCGGCGGCGG - Exonic
969674579 4:8607781-8607803 TTTCCGGGAGGCGCCGGCAGAGG + Intronic
970202883 4:13627493-13627515 GGGCCCGGCGGCGGCGGCGGTGG + Exonic
970333007 4:15003718-15003740 CACCCGGGCGGCGGCGGCGGCGG + Exonic
970333084 4:15003949-15003971 ACCCCGGGCGGCGGCAGCGGCGG + Exonic
970333130 4:15004165-15004187 ATGGCGGGCGGCGGCGGAGGGGG - Exonic
970333133 4:15004168-15004190 TTCATGGCGGGCGGCGGCGGAGG - Exonic
970456241 4:16226634-16226656 TACCGTGGCGGCGGCGGCGGCGG - Intronic
971018948 4:22515684-22515706 CTGCTGGGAGGCGGCGGCGGCGG - Exonic
971406030 4:26321253-26321275 AGGGCGGGCGGCGGCGGCGGCGG + Intronic
972321554 4:37977362-37977384 CTCCCCGGCGGCGGCGGCGGCGG - Intronic
972533050 4:39977566-39977588 CGGGCGGGCGGCGGCGGCGGCGG - Exonic
972725775 4:41745777-41745799 TCCTGCGGCGGCGGCGGCGGCGG - Exonic
973137313 4:46724418-46724440 TCGCTGGGCCGCGGCGGCGGCGG + Intergenic
973820551 4:54658400-54658422 TGCGCGGGGGGCGGAGGCGGGGG + Intronic
974047137 4:56907864-56907886 CCCGCGGGCGGTGGCGGCGGCGG + Intronic
974047247 4:56908260-56908282 CGCCCGGGCGGCGGCAGTGGCGG + Intronic
974385662 4:61200577-61200599 GTCACAGGCGGCGGTGGCGGCGG - Intergenic
975166893 4:71187279-71187301 TTCGGTGGCGGCGGCGGCCGCGG + Exonic
975342639 4:73258803-73258825 TGGCGGAGCGGCGGCGGCGGCGG - Intergenic
975778961 4:77819608-77819630 GGTCCGGGCGGCGGCGGCGGCGG + Intronic
975985958 4:80202066-80202088 CACGGGGGCGGCGGCGGCGGTGG + Exonic
976390016 4:84497705-84497727 AGCCCGGGCGGCGGCGGCGGCGG + Exonic
976600713 4:86935288-86935310 GTCCGCGGCGGCGGCGTCGGGGG - Intronic
976774907 4:88697697-88697719 TAGCCAGGCGGCGGCAGCGGCGG - Exonic
977257544 4:94757910-94757932 TCCCGCGGTGGCGGCGGCGGCGG + Intergenic
977809921 4:101346889-101346911 TTGCAGCGCGGCGGCGGCGGCGG - Exonic
978072540 4:104491324-104491346 CTCCCCGCCGGCGGTGGCGGCGG - Exonic
978541018 4:109816249-109816271 TTCCGAGGTGGAGGCGGCGGTGG + Exonic
978777203 4:112516018-112516040 AGCCCCGGCGGCGGCGGCGGCGG + Exonic
979349664 4:119628962-119628984 TTCCCAGGAGGCGGCGGCGGCGG + Exonic
979674677 4:123398342-123398364 CTCCTGGCCGGTGGCGGCGGGGG + Intronic
979785577 4:124712434-124712456 TAACCGGGGGGCGGCGGCGGCGG - Intronic
979785648 4:124712704-124712726 TGCCCTGACGGCGGCGGCGGCGG - Exonic
979832039 4:125315647-125315669 AACAGGGGCGGCGGCGGCGGCGG + Intergenic
980053798 4:128061543-128061565 TCGGCGGGCGGCGGCAGCGGCGG + Intronic
980130064 4:128809969-128809991 TCCCGCGGCGGCGACGGCGGCGG + Intronic
980920908 4:139084433-139084455 GGCAGGGGCGGCGGCGGCGGCGG + Intronic
981270742 4:142845721-142845743 TCCCAGGCCGGCGGCGGCGGCGG + Intronic
984206288 4:176792213-176792235 CTCGAAGGCGGCGGCGGCGGCGG + Exonic
984811448 4:183798524-183798546 TCCCTGGGCGGCGACTGCGGGGG + Intergenic
984888761 4:184473564-184473586 CTTCTGAGCGGCGGCGGCGGCGG + Intronic
984923408 4:184785592-184785614 CTCCTGGGCGGGGGCGGGGGGGG + Intronic
985006007 4:185535663-185535685 CTCCCGGGCCGCGGCGGGCGCGG + Intergenic
985532685 5:443224-443246 GGCGGGGGCGGCGGCGGCGGCGG + Exonic
985629987 5:1009173-1009195 CTTGCGGGCGGCGGCGGCTGCGG - Exonic
985651895 5:1111439-1111461 TTACCGGACGGCCGCGGCGCAGG + Intronic
985696699 5:1344956-1344978 TTCCCCCGCGGCGGTGGCGGTGG - Exonic
985895485 5:2748313-2748335 CTCCCGGGCGCCGCCGGCCGCGG + Intronic
986330463 5:6713469-6713491 TGCGGCGGCGGCGGCGGCGGCGG - Intergenic
986330465 5:6713472-6713494 TCCTGCGGCGGCGGCGGCGGCGG - Intergenic
986330752 5:6714401-6714423 CGGCCGGGCGGCGGCCGCGGCGG + Intergenic
986402789 5:7396047-7396069 CTCCCGCGCGGTGGCGGTGGCGG + Intergenic
986813658 5:11385159-11385181 TCCCGCGGCGGCGGCGGCGGCGG + Exonic
987087975 5:14487499-14487521 AGCGGGGGCGGCGGCGGCGGCGG + Exonic
987132393 5:14871817-14871839 CCTCCGGGCGGCGGCGGCGGCGG - Intergenic
987258261 5:16179463-16179485 TCTCCCGGCGGCGGCGTCGGCGG + Exonic
988437530 5:31193805-31193827 GACCGCGGCGGCGGCGGCGGCGG + Exonic
988547791 5:32174283-32174305 CTCCAAGGCGGAGGCGGCGGCGG + Exonic
988577837 5:32444245-32444267 CAGCGGGGCGGCGGCGGCGGCGG - Exonic
988825302 5:34929663-34929685 GAGCCCGGCGGCGGCGGCGGCGG - Exonic
989571617 5:42951181-42951203 TTACCGGGCGGCGGCGGCGCTGG - Intergenic
989584815 5:43066509-43066531 TTCCCGGGCGACGCCGGCGCTGG - Intronic
990825427 5:59893354-59893376 GCCCCGGGCGGCGGCGGGGGCGG + Exonic
990955024 5:61332321-61332343 CGGCCGGGCGGCGGCGGCGGCGG + Exonic
990955122 5:61332708-61332730 GGCGCGGGCGGCGGCGGCGGCGG + Exonic
990955146 5:61332805-61332827 CCCCGCGGCGGCGGCGGCGGCGG - Exonic
990955149 5:61332808-61332830 GGCCCCCGCGGCGGCGGCGGCGG - Exonic
992105784 5:73448198-73448220 TCCCCGCGCAGCGGCGGCGGCGG - Exonic
992487430 5:77210394-77210416 GGCCCGGGCGGCTGCGGCCGCGG + Intergenic
993726948 5:91380223-91380245 CGCGCGGGCGGCAGCGGCGGCGG - Intronic
993900506 5:93581271-93581293 ACCCCCGGCGGCGGCAGCGGCGG + Intergenic
994107324 5:95961740-95961762 AGCCGGAGCGGCGGCGGCGGCGG - Exonic
995106237 5:108381012-108381034 TGCGGCGGCGGCGGCGGCGGCGG - Exonic
995354714 5:111224430-111224452 CGCTCGGGCAGCGGCGGCGGCGG + Exonic
996290995 5:121852112-121852134 GTCCCGGGAGGAGGCGGCTGCGG - Exonic
996404175 5:123090171-123090193 TCCGGGGGCGGGGGCGGCGGCGG - Exonic
996862816 5:128084236-128084258 TGCTGCGGCGGCGGCGGCGGCGG + Exonic
996862817 5:128084239-128084261 TGCGGCGGCGGCGGCGGCGGCGG + Exonic
997013383 5:129904563-129904585 TCTCCCGGCGGCGGCGGTGGCGG - Exonic
997201317 5:132011645-132011667 ATACCCGGCAGCGGCGGCGGCGG - Exonic
997500728 5:134371472-134371494 CTCGGCGGCGGCGGCGGCGGCGG + Exonic
997975420 5:138439127-138439149 AGGCCGAGCGGCGGCGGCGGCGG - Exonic
998143228 5:139711328-139711350 CTCGGCGGCGGCGGCGGCGGCGG - Intergenic
998199416 5:140107828-140107850 GTCTGCGGCGGCGGCGGCGGCGG + Intronic
998203900 5:140145908-140145930 TTCCGCCGCGGCGGCGGCTGCGG + Intergenic
998963119 5:147509535-147509557 TACCCCGGCGGGGGCGGGGGAGG + Exonic
999753369 5:154646836-154646858 TTCCCGAGGAGCGACGGCGGCGG - Intergenic
1000193922 5:158939746-158939768 TTTCCGGGCGGGGGTGGGGGAGG + Intronic
1000302891 5:159972054-159972076 CGCCCAGGCGACGGCGGCGGCGG - Exonic
1000319025 5:160119159-160119181 TCCCCCGGCGGCGGCGGTGGCGG + Exonic
1001070314 5:168579585-168579607 TCTCAGTGCGGCGGCGGCGGCGG - Exonic
1001688745 5:173616414-173616436 ATGGCGGACGGCGGCGGCGGCGG - Exonic
1002001060 5:176196491-176196513 TTCCTGGGAGGTGGGGGCGGGGG - Intergenic
1002029304 5:176416300-176416322 TGCCCCGGAGGCGGCGGAGGAGG - Exonic
1002058068 5:176610052-176610074 CGCTCGGGCGGCGGCGGCGGCGG - Exonic
1002219945 5:177672212-177672234 TTCTGAGGTGGCGGCGGCGGGGG + Intergenic
1002253275 5:177942481-177942503 TTCCTGGGAGGTGGGGGCGGGGG + Intergenic
1002291627 5:178204579-178204601 TTCCCGTGCGGCGGCGGCCAAGG + Exonic
1002352039 5:178590124-178590146 GCGGCGGGCGGCGGCGGCGGAGG - Exonic
1002455901 5:179345222-179345244 TTCGCGGGCGGCGGCGGCGGCGG + Exonic
1002491082 5:179577759-179577781 TGGTCGGGCGGCGGAGGCGGTGG + Intronic
1002580938 5:180209135-180209157 CGGTCGGGCGGCGGCGGCGGCGG - Intronic
1002591072 5:180291977-180291999 TGCGGCGGCGGCGGCGGCGGCGG - Exonic
1002666774 5:180831186-180831208 CCCCGAGGCGGCGGCGGCGGCGG - Intergenic
1002897961 6:1390054-1390076 CTCCGGGGCGGCGGCGGCGGCGG - Exonic
1002897997 6:1390170-1390192 AGCGCGGGCGGCGGCGGCGCGGG + Exonic
1002926997 6:1610520-1610542 CTACCGCGCGGCGGCCGCGGCGG + Exonic
1002927243 6:1611562-1611584 AGCTCGGGCGGCGGCGGCGGCGG + Exonic
1003206948 6:4021389-4021411 CTCCTCGGCGGCGGTGGCGGCGG - Exonic
1003551834 6:7107685-7107707 GGCCGCGGCGGCGGCGGCGGCGG - Intronic
1003551837 6:7107694-7107716 TTACTGAGCGGCCGCGGCGGCGG - Intronic
1003624095 6:7727056-7727078 CCCCCCGGCGGCGGCGGCCGCGG - Exonic
1003645532 6:7910644-7910666 GGCCCAGGAGGCGGCGGCGGCGG - Exonic
1004044691 6:12012450-12012472 CCCCCGCGCGGCGGCGGCGGCGG - Exonic
1004216791 6:13711273-13711295 GCCGGGGGCGGCGGCGGCGGAGG + Exonic
1004216847 6:13711471-13711493 TGCTGCGGCGGCGGCGGCGGCGG + Exonic
1004395895 6:15246049-15246071 TCCAGCGGCGGCGGCGGCGGCGG - Intergenic
1004864280 6:19837871-19837893 AGCCGCGGCGGCGGCGGCGGCGG + Exonic
1004924054 6:20402375-20402397 GCCCGGGGCGGCGGCAGCGGCGG - Exonic
1005040344 6:21595189-21595211 ATCCTGGCAGGCGGCGGCGGCGG + Exonic
1005040346 6:21595192-21595214 CTGGCAGGCGGCGGCGGCGGCGG + Exonic
1005854414 6:29850166-29850188 CTCCCGGGCGGGGCCGGAGGCGG + Intergenic
1005940476 6:30556275-30556297 GTCCCGGGCCCCTGCGGCGGGGG - Exonic
1006302354 6:33200323-33200345 TCCCGCAGCGGCGGCGGCGGCGG - Exonic
1006336906 6:33425714-33425736 TTCCTGGGAGGAGGCGGAGGGGG + Intronic
1006472507 6:34236740-34236762 CACCCGCGCGGCAGCGGCGGCGG + Intergenic
1006472659 6:34237334-34237356 GCCCGCGGCGGCGGCGGCGGAGG + Intronic
1006558561 6:34889496-34889518 TTTGGGGGCGGCGGCGGCGGTGG + Exonic
1006725493 6:36196784-36196806 TCCCCCGGGAGCGGCGGCGGCGG + Exonic
1007557824 6:42782032-42782054 AACAGGGGCGGCGGCGGCGGCGG - Exonic
1007737696 6:43991805-43991827 GTCGGGGGCGGCGGGGGCGGGGG + Intergenic
1007784200 6:44270776-44270798 GCCGCCGGCGGCGGCGGCGGCGG + Exonic
1008013380 6:46491416-46491438 GTCCCGGGTGACGGCGGCGGAGG - Intronic
1008932470 6:56954938-56954960 GGCCCGGGCGGCCGCGGCGGCGG - Intergenic
1011416249 6:87122761-87122783 TCGCAGCGCGGCGGCGGCGGCGG + Intergenic
1011418914 6:87152046-87152068 TTCGCGGGCGGCGGCGGCGGCGG + Intergenic
1011610436 6:89145971-89145993 TTCCCGCGCGGCGCCGGGGGCGG + Intergenic
1011610593 6:89146586-89146608 TTCACGGGCGGAGGCGGCCTGGG - Exonic
1012399996 6:98835069-98835091 TCCCACGGCGGCGGCGGCGGGGG + Exonic
1012400118 6:98835588-98835610 TGCGGGGGCGGCGGGGGCGGCGG - Exonic
1012475778 6:99613752-99613774 AGGCCAGGCGGCGGCGGCGGCGG - Exonic
1013155800 6:107490250-107490272 CGGCCCGGCGGCGGCGGCGGCGG + Exonic
1013170830 6:107635080-107635102 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1013272644 6:108558396-108558418 TTGCTGGGGGGCGGGGGCGGGGG + Intergenic
1013836547 6:114342199-114342221 GTCCCCGGCGGTGGCGGCGCGGG + Exonic
1013836601 6:114342415-114342437 CACGCAGGCGGCGGCGGCGGCGG + Exonic
1014035588 6:116764691-116764713 TTGCGGGGCGGCTGTGGCGGGGG - Intronic
1014137542 6:117907194-117907216 GGCGCCGGCGGCGGCGGCGGCGG - Intergenic
1014137624 6:117907479-117907501 GGGGCGGGCGGCGGCGGCGGCGG + Intergenic
1014230368 6:118895252-118895274 ATCCCGGGCGCCGGCCGAGGAGG - Intronic
1014632552 6:123804009-123804031 TGGCGCGGCGGCGGCGGCGGCGG - Intergenic
1014632553 6:123804012-123804034 TGCTGGCGCGGCGGCGGCGGCGG - Intergenic
1014947583 6:127516031-127516053 CCCCTGGGCGGCGGCGGCTGCGG + Exonic
1015148924 6:130018505-130018527 CTCCCCGGCAGCGGCGGCGGCGG + Exonic
1015149264 6:130019968-130019990 GTGTCGGGAGGCGGCGGCGGCGG + Intronic
1015220628 6:130801465-130801487 AGCCGGGGTGGCGGCGGCGGTGG + Intergenic
1016960295 6:149666538-149666560 AACCCGGGAGGCGGTGGCGGAGG + Intronic
1017164157 6:151391551-151391573 CTCCGGCGCGGCGGCGGCGGCGG + Intergenic
1017672243 6:156778735-156778757 GGCCCCGGCGGCGGCGGCGGAGG - Exonic
1017672282 6:156778842-156778864 GGCGCGGGCGGCGGCGGCGGCGG + Exonic
1017672415 6:156779291-156779313 GTCCCAGGCGGCGGCGGCGGGGG + Exonic
1017793624 6:157823033-157823055 CCCGGGGGCGGCGGCGGCGGCGG + Intronic
1017842333 6:158232161-158232183 AGCCGGGCCGGCGGCGGCGGCGG + Intergenic
1018400492 6:163415139-163415161 CTCTCCGGCGGCGGCGGCGGCGG + Exonic
1018400493 6:163415142-163415164 TCCGGCGGCGGCGGCGGCGGCGG + Exonic
1019111927 6:169724009-169724031 GGCCCGCGCGGCGGCGGCGGCGG - Exonic
1019308229 7:346554-346576 GCCCCGGGCGGCTGCGGTGGTGG - Intergenic
1019308239 7:346588-346610 GCCCCGGGCGGCGGCGGTGGTGG - Intergenic
1019308259 7:346656-346678 GCCCCGGGCGGCGGCGGTGGTGG - Intergenic
1019308278 7:346723-346745 GCCCCGGGCGGCGGCGGTGGTGG - Intergenic
1019308289 7:346757-346779 GCCCCGGGCGGCGGCAGTGGTGG - Intergenic
1019308308 7:346825-346847 GCCCCGGGTGGCGGCGGTGGTGG - Intergenic
1019343663 7:519758-519780 TCTCCCGGCGGCGGCTGCGGCGG - Intronic
1019474248 7:1236433-1236455 CCCCGCGGCGGCGGCGGCGGCGG - Exonic
1019487854 7:1297460-1297482 TTCCCGGGCCTCGGAGGCAGGGG - Intergenic
1019562635 7:1666082-1666104 TTCCCCGAGCGCGGCGGCGGCGG - Intergenic
1019614071 7:1950981-1951003 TTCCTGGGAGGAGGAGGCGGGGG + Intronic
1019743770 7:2688415-2688437 CGCCCGGGCGGCGGCGGCTACGG + Intronic
1019828223 7:3301266-3301288 GCGCCGGGCGGGGGCGGCGGCGG + Intergenic
1019828226 7:3301272-3301294 GGCGGGGGCGGCGGCGGCGGCGG + Intergenic
1020020195 7:4861855-4861877 GACCCGGGCGGCGGCCGCGAAGG - Exonic
1020105628 7:5421095-5421117 TTCCCGGGCGGCAGCGGGCCGGG + Exonic
1020178067 7:5898698-5898720 TTCCGGGGCGGTGGCGACGGAGG + Intergenic
1020204545 7:6104906-6104928 TGACCCGGAGGCGGCGGCGGCGG + Exonic
1020238527 7:6374704-6374726 TCGCTGGGCCGCGGCGGCGGCGG - Exonic
1020252968 7:6484052-6484074 GTTCATGGCGGCGGCGGCGGTGG + Exonic
1020278308 7:6637515-6637537 CTCGGGGGCGGCGGCGGCGGCGG + Intronic
1020304860 7:6826277-6826299 TTCCGGGGCGGTGGCGACGGAGG - Exonic
1021231101 7:18086897-18086919 CCCCCGCGCGGCGGCGGCGGCGG + Intergenic
1021451255 7:20785341-20785363 TCCGGGGGCAGCGGCGGCGGCGG - Exonic
1021452773 7:20798053-20798075 GGCCCGGGCTGCGGCGGCCGCGG + Intergenic
1021633030 7:22665261-22665283 TTCCCGGGGGTGGGGGGCGGAGG - Intergenic
1021827915 7:24573270-24573292 CGCCCAAGCGGCGGCGGCGGCGG + Intronic
1022101096 7:27169615-27169637 CTCCTTGGCGGCGGCGGCAGCGG - Intronic
1022101922 7:27174008-27174030 TCGCCGGGCAGCGGTGGCGGTGG - Exonic
1022101955 7:27174143-27174165 GGCGCGGGGGGCGGCGGCGGTGG - Exonic
1022113037 7:27243130-27243152 TTCTCGGGCGGCTCCGGCAGCGG - Exonic
1022485124 7:30771815-30771837 CTCCGGGGCGGCGGCAGCTGGGG + Intronic
1022739724 7:33109413-33109435 GGCTCCGGCGGCGGCGGCGGCGG + Intergenic
1022739725 7:33109416-33109438 TCCGGCGGCGGCGGCGGCGGCGG + Intergenic
1022739737 7:33109492-33109514 TTGCGGGGCGGCGGCGGGAGGGG - Intergenic
1023405799 7:39833208-39833230 TGAGAGGGCGGCGGCGGCGGCGG + Intergenic
1023417892 7:39949852-39949874 TCTGCTGGCGGCGGCGGCGGCGG + Intergenic
1023955597 7:44884720-44884742 GGCCCGGGAGGCGGCGCCGGGGG - Exonic
1024313521 7:47991938-47991960 TTCTGGGGCGGCGCCGGCAGTGG - Intronic
1024802856 7:53101127-53101149 TTCCGCGGCGGGGGGGGCGGGGG - Intergenic
1025069678 7:55887594-55887616 GTCCACCGCGGCGGCGGCGGCGG + Intronic
1025069680 7:55887597-55887619 CACCGCGGCGGCGGCGGCGGCGG + Intronic
1025069777 7:55887834-55887856 GCGGCGGGCGGCGGCGGCGGCGG + Intronic
1025069786 7:55887857-55887879 GCGGCGGGCGGCGGCGGCGGCGG + Intronic
1025069795 7:55887882-55887904 GCGGCGGGCGGCGGCGGCGGCGG + Intronic
1025155876 7:56605638-56605660 TTCCAGCGTGGCGGGGGCGGTGG + Intergenic
1025615708 7:63114424-63114446 TGCCGCGGCGGCGGCGGCGGCGG + Intergenic
1025806525 7:64838577-64838599 TTCCCGAGAGGAGGCGGCTGAGG - Intergenic
1026360534 7:69598380-69598402 GAGGCGGGCGGCGGCGGCGGCGG + Intergenic
1027374540 7:77537198-77537220 TCCTGAGGCGGCGGCGGCGGCGG + Intergenic
1027421155 7:78019490-78019512 GGCCCGGGCGGCGGCGGCAGCGG - Exonic
1028173720 7:87628857-87628879 ATCCGCGGCGGTGGCGGCGGAGG + Exonic
1028477058 7:91264704-91264726 TTCCGCGGCGGCGGCGGCTGCGG + Exonic
1028621487 7:92833567-92833589 TCCTCCGGCGGCGGCGGCGGCGG - Exonic
1028871137 7:95772702-95772724 CTCCTGGGCGGCGGCAGCGTTGG - Exonic
1028922336 7:96322034-96322056 AGTCCCGGCGGCGGCGGCGGTGG + Exonic
1028985553 7:97006116-97006138 TGCGGCGGCGGCGGCGGCGGCGG - Exonic
1029281560 7:99438948-99438970 CCCTCGGGCGGCGGCGGCGGCGG + Intronic
1029281592 7:99439069-99439091 TTCCTGCATGGCGGCGGCGGCGG - Exonic
1029372420 7:100158207-100158229 ATGCCGGGGGGCGGCGGCGCCGG - Exonic
1029456217 7:100673842-100673864 CTCCGCGGCGGAGGCGGCGGCGG - Exonic
1029456219 7:100673845-100673867 TTCCTCCGCGGCGGAGGCGGCGG - Exonic
1029640257 7:101815901-101815923 GTCCTCGGTGGCGGCGGCGGCGG + Intronic
1029640536 7:101816752-101816774 GCCACCGGCGGCGGCGGCGGCGG + Intronic
1029996755 7:105014156-105014178 GGCCGCGGCGGCGGCGGCGGCGG - Intergenic
1030033446 7:105388928-105388950 TGCTGGAGCGGCGGCGGCGGCGG - Intronic
1030138734 7:106284667-106284689 GGCGCGGGCGGCGGCGGCTGGGG - Intronic
1030176499 7:106660421-106660443 TCCTCGGGGGGCGGCGGCGGTGG + Exonic
1030262481 7:107580246-107580268 GTCCCGCGCGTCGGCGGCCGCGG + Intronic
1030727197 7:112939761-112939783 CTGAGGGGCGGCGGCGGCGGCGG - Exonic
1030820724 7:114087614-114087636 CGCACGTGCGGCGGCGGCGGCGG + Intronic
1031051881 7:116953438-116953460 CGCCCGGGCCGCGGCGGCGGCGG + Exonic
1031361984 7:120857973-120857995 TTCCCAGGAGGCGGCGACGGCGG - Exonic
1031447558 7:121873164-121873186 TTCGCCGGCTGCGGCGGCCGCGG - Exonic
1031886858 7:127252865-127252887 TCACGCGGCGGCGGCGGCGGCGG - Exonic
1032074496 7:128830170-128830192 TTCCAGCGCGGCGGCACCGGGGG + Intergenic
1032174358 7:129611696-129611718 CTCCTCGGCGGCGGCGGCGGCGG + Exonic
1032193974 7:129779516-129779538 TTCCCGGGCGGGGGCGGGGGCGG - Intergenic
1032194372 7:129780822-129780844 GTTCCCGGCGGCGGCGGCAGCGG - Intergenic
1032306231 7:130734190-130734212 CGCGCGGGCGGCGGCGGCAGCGG - Intergenic
1032781496 7:135168294-135168316 TTGCCGGGGGGGGGCGGGGGGGG - Intronic
1033253191 7:139777820-139777842 GGCCCGGGCGGCAGCGGCGGCGG - Intronic
1033299972 7:140176822-140176844 TACACGGGCGGGGGCGGCGGAGG + Exonic
1033299993 7:140176913-140176935 GGCCGGAGCGGCGGCGGCGGTGG - Exonic
1033654351 7:143362780-143362802 GAGCCAGGCGGCGGCGGCGGCGG - Intergenic
1034147258 7:148884214-148884236 AGCCCCGGCGGCGGCGGCGGCGG - Exonic
1034147401 7:148884729-148884751 TTCCCGGGCGGGGGAGGGGCGGG + Intergenic
1034455460 7:151167651-151167673 CTCCCGGGCCGAGGTGGCGGCGG + Intronic
1034469723 7:151248758-151248780 AGCCGCGGCGGCGGCGGCGGCGG - Exonic
1034483531 7:151341705-151341727 TTTCCAAGCGGCGGCGGCGGCGG + Exonic
1034494187 7:151410224-151410246 GACCCAGGCGGCGGCGGCGGAGG - Intronic
1035161091 7:156950231-156950253 TTTCCGGGCAGCGGCGGTGGCGG - Exonic
1035169536 7:157009943-157009965 GCCCCCAGCGGCGGCGGCGGCGG + Exonic
1035169565 7:157010037-157010059 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1035169568 7:157010043-157010065 TTCCTGGGCGCGGGCGGCGGCGG - Exonic
1035171113 7:157017992-157018014 CTCCCGGGCTGCGGCTCCGGGGG - Intergenic
1035553014 8:544653-544675 CGCCTGGGCGGCGGCGGCGGCGG + Exonic
1035581042 8:738997-739019 TTCACCGGCGGCGGCGGCGGCGG - Intergenic
1036733337 8:11284863-11284885 TTCCCTGGCTCCGGCCGCGGGGG + Exonic
1036789503 8:11708674-11708696 TTCCCGGGCCGCGGCAGCGGCGG - Exonic
1037535223 8:19817432-19817454 CTCCCCCGCGGTGGCGGCGGCGG + Exonic
1037811401 8:22089212-22089234 CTCCCGGGCGAAAGCGGCGGCGG - Exonic
1037928850 8:22865552-22865574 TTCCCCGGCGGCTGCGGCACCGG - Intronic
1038152655 8:24956532-24956554 TCCCCGGCCCGCGGCGGCGGTGG + Exonic
1038575641 8:28701612-28701634 CGCGCAGGCGGCGGCGGCGGCGG + Exonic
1039921459 8:41896780-41896802 CTCTCCTGCGGCGGCGGCGGCGG + Intergenic
1040065593 8:43141296-43141318 CTCCCAGGCGGCGGCGGCGGCGG - Intronic
1041059499 8:54022273-54022295 GCCCGCGGCGGCGGCGGCGGCGG + Exonic
1041167368 8:55102741-55102763 GGCCCGGGCGGCGGCGGGGCGGG + Exonic
1041280996 8:56211308-56211330 GTCGGCGGCGGCGGCGGCGGCGG - Intronic
1041552683 8:59119263-59119285 CTGCCCGGCGGCGGCGGCAGCGG - Intergenic
1041689757 8:60678225-60678247 TGCGCGGCCGGCGGCGGCCGGGG - Intergenic
1041689913 8:60678755-60678777 TGCTGGGGCCGCGGCGGCGGCGG + Intergenic
1041689915 8:60678761-60678783 GGCCGCGGCGGCGGCGGCGGCGG + Exonic
1041690084 8:60679353-60679375 CGCCGGGCCGGCGGCGGCGGGGG + Intronic
1041690396 8:60680409-60680431 GGCGGGGGCGGCGGCGGCGGCGG + Intronic
1041919799 8:63168832-63168854 GGCCCAGGCAGCGGCGGCGGCGG + Exonic
1042040032 8:64580724-64580746 CTCCGGGGCCGAGGCGGCGGCGG + Exonic
1042040218 8:64581385-64581407 GGCCTGGGCGGCGGCGGCGGCGG + Exonic
1042155692 8:65841974-65841996 TCCGGCGGCGGCGGCGGCGGCGG - Intronic
1042155693 8:65841977-65841999 GACTCCGGCGGCGGCGGCGGCGG - Intronic
1042916180 8:73878384-73878406 TGCCGGGGCAGGGGCGGCGGGGG - Intronic
1042962870 8:74321501-74321523 GGCCCAGGCGGCGGCGGCGAAGG - Intronic
1043388252 8:79768308-79768330 CGCGCTGGCGGCGGCGGCGGCGG + Intergenic
1043428453 8:80171539-80171561 TTCGCGGGAGTCGCCGGCGGAGG - Intronic
1043463921 8:80486780-80486802 GCACCGGGCGGCGGCGGCGGCGG + Exonic
1043464034 8:80487183-80487205 TTCCGAGGCGGCGGCGGCGGGGG + Exonic
1043502958 8:80874325-80874347 CTCCCGGGCGGCGGCGGCGGCGG - Intronic
1043847288 8:85177526-85177548 CCCCCGAGCTGCGGCGGCGGGGG - Exonic
1044821881 8:96160713-96160735 TCCCCAGGAGGCGGTGGCGGCGG + Exonic
1045231183 8:100309435-100309457 TTGCCGCGGGGAGGCGGCGGGGG - Intronic
1045231239 8:100309598-100309620 CTCCCGGGCCGCGGGGGCCGAGG - Intronic
1045305075 8:100951473-100951495 TGACTCGGCGGCGGCGGCGGCGG - Intronic
1045327284 8:101126653-101126675 TCACCGGGCGGGGGCGGCTGGGG - Intergenic
1045516299 8:102863630-102863652 GCCCCCGGCGGCGGCGGCGGCGG - Intronic
1045674064 8:104588979-104589001 CTCGGCGGCGGCGGCGGCGGCGG - Exonic
1045674065 8:104588982-104589004 TGGCTCGGCGGCGGCGGCGGCGG - Exonic
1046103902 8:109644687-109644709 CTCCTGGACGGCGGCAGCGGCGG - Exonic
1046547208 8:115667931-115667953 TGCAGTGGCGGCGGCGGCGGCGG + Intronic
1046547433 8:115669111-115669133 GTCCCGGCGGGCGGCGGCGGCGG - Intronic
1046932592 8:119856041-119856063 TTCCCGGGGGGCGGTCTCGGCGG + Intergenic
1048214266 8:132480869-132480891 CTCCGGGGCGGCGGCGGCGGCGG + Exonic
1049109851 8:140635786-140635808 GTCCGCGGCGGCGGCGGCGGCGG + Intergenic
1049557504 8:143290477-143290499 ATGCCGGGTGGCGGCGGCGCGGG + Intronic
1049585085 8:143429307-143429329 GTCCCCGGCGACGGCGGCGCGGG + Exonic
1049585307 8:143430171-143430193 AGCCCGGGCACCGGCGGCGGCGG - Exonic
1049585629 8:143431175-143431197 TCCGCTAGCGGCGGCGGCGGCGG + Intergenic
1049662162 8:143824351-143824373 GTCCGAGCCGGCGGCGGCGGCGG - Exonic
1049670045 8:143865349-143865371 GCGGCGGGCGGCGGCGGCGGCGG + Exonic
1049689791 8:143953458-143953480 TGCAGCGGCGGCGGCGGCGGCGG - Intronic
1049788439 8:144462375-144462397 GGCCGAGGCGGCGGCGGCGGCGG - Intronic
1049828374 8:144685007-144685029 TTCCCGGGCGCCGTCGGAGTGGG - Intergenic
1049828615 8:144685818-144685840 TGGGCCGGCGGCGGCGGCGGAGG - Intergenic
1050325055 9:4490509-4490531 ATCCCGGGTGGCGGCGGCAACGG + Exonic
1051206375 9:14693315-14693337 GGCCTGGGCGGCGGCGCCGGAGG - Exonic
1051248487 9:15135952-15135974 AACCCGGGAGGCGGAGGCGGAGG - Intergenic
1051855504 9:21559908-21559930 TTCCGCGGCGGTCGCGGCGGCGG - Intergenic
1052192793 9:25678182-25678204 AGCCCCAGCGGCGGCGGCGGCGG - Exonic
1052362160 9:27573217-27573239 CTTCCCGGCGGCGGCGGCGGCGG - Intronic
1052970240 9:34372886-34372908 AGCCAGGCCGGCGGCGGCGGGGG + Exonic
1053003319 9:34589700-34589722 AGAGCGGGCGGCGGCGGCGGCGG - Exonic
1053066425 9:35072365-35072387 CTCCCGGCCGGCGGCTGTGGCGG + Exonic
1053114610 9:35490122-35490144 CGCGCCGGCGGCGGCGGCGGCGG - Intronic
1053114612 9:35490125-35490147 TTCCGCGCCGGCGGCGGCGGCGG - Intronic
1053152005 9:35749317-35749339 GTACGCGGCGGCGGCGGCGGCGG - Exonic
1053239943 9:36487406-36487428 GGCCGGGGCGGCGGCGGTGGGGG + Intronic
1053372727 9:37576244-37576266 TTCCAGGGCACCGGCGGCCGCGG - Exonic
1053697500 9:40651084-40651106 AGCCGCGGCGGCGGCGGCGGCGG + Intergenic
1053739885 9:41127239-41127261 TGTCCGAGCAGCGGCGGCGGCGG + Exonic
1054308789 9:63450484-63450506 AGCCGCGGCGGCGGCGGCGGCGG + Intergenic
1054688465 9:68304074-68304096 TGTCCGAGCAGCGGCGGCGGCGG - Exonic
1054762322 9:69014119-69014141 TCTCGCGGCGGCGGCGGCGGCGG + Intergenic
1054798630 9:69325392-69325414 CTCCTGAGCGGCGGCGGCAGCGG - Intronic
1054835573 9:69672290-69672312 GGTCCCGGCGGCGGCGGCGGCGG - Exonic
1055091113 9:72365279-72365301 AACCCCGGCGGCGGCGGCGGCGG + Intergenic
1055266309 9:74498812-74498834 GTCGCAGGCGGTGGCGGCGGCGG + Intronic
1055514160 9:77020147-77020169 GGCGGGGGCGGCGGCGGCGGCGG - Exonic
1055514206 9:77020317-77020339 GGCCGTGGCGGCGGCGGCGGCGG + Exonic
1055611781 9:78031593-78031615 CTCGCAGGCGGCGGCGGCGGCGG - Intergenic
1055945716 9:81689507-81689529 GGCGCGGGCGGCGGCGGCGGTGG - Intergenic
1057075664 9:92136942-92136964 TTCCCGGGCTGGGGCTGCTGGGG + Intergenic
1057146925 9:92764815-92764837 GGGCAGGGCGGCGGCGGCGGCGG - Intergenic
1057489146 9:95508369-95508391 CCCCGCGGCGGCGGCGGCGGCGG - Exonic
1057596209 9:96417971-96417993 ATGACGGGCGGCGGCGGCGGCGG + Exonic
1057772861 9:97983501-97983523 TTCCGCGGCGGGGGCGGAGGGGG - Exonic
1057869706 9:98708673-98708695 CGCGCGGGCGGCGGTGGCGGCGG + Exonic
1057996128 9:99822744-99822766 CTCGGCGGCGGCGGCGGCGGCGG + Intronic
1058053287 9:100427256-100427278 ACGCCGGGCGGCGGCGGCGGCGG - Intronic
1058467546 9:105244587-105244609 GGGGCGGGCGGCGGCGGCGGCGG - Intergenic
1058467566 9:105244661-105244683 TCCCCCGGCGGCGGCGACGGCGG - Exonic
1059102395 9:111483511-111483533 ATCCTGGGAGGCGGAGGCGGCGG + Intronic
1059283043 9:113150979-113151001 TATCGCGGCGGCGGCGGCGGCGG + Exonic
1059483710 9:114611525-114611547 TCCCGGGGTGGCGGCGGCGGCGG + Exonic
1059633940 9:116154350-116154372 CCGCCCGGCGGCGGCGGCGGCGG - Exonic
1059633954 9:116154393-116154415 TCCCCCGGCGGCGGCAGCAGCGG + Exonic
1059769823 9:117414765-117414787 CTCCCGCGAGGCAGCGGCGGTGG + Exonic
1059769885 9:117414957-117414979 GCTGCGGGCGGCGGCGGCGGTGG + Exonic
1060268700 9:122126859-122126881 TTATAGTGCGGCGGCGGCGGCGG - Intergenic
1060468707 9:123930056-123930078 ACCCCTGGAGGCGGCGGCGGCGG - Exonic
1060770223 9:126326981-126327003 CGCTGGGGCGGCGGCGGCGGTGG - Exonic
1060849189 9:126860672-126860694 TGGCCTGGCGCCGGCGGCGGCGG + Intronic
1061033408 9:128100328-128100350 CTCCTGGGAGGCGGGGGCGGGGG + Intronic
1061060500 9:128247876-128247898 CTCCCTGGTGGTGGCGGCGGTGG + Intronic
1061144119 9:128787268-128787290 TCCCTGGGGGGCGGCGGCGGCGG + Exonic
1061144122 9:128787271-128787293 CTGGGGGGCGGCGGCGGCGGCGG + Exonic
1061449663 9:130661248-130661270 GGCCCGGGCGGCGGCGGCAGCGG + Intergenic
1061453501 9:130681623-130681645 GTGCGCGGCGGCGGCGGCGGCGG - Exonic
1061541079 9:131278037-131278059 TCCGCAGGCGGCGGCGGCGGCGG + Intergenic
1061542116 9:131283064-131283086 TTCCCCGGCGGCGGGGGGCGGGG - Intergenic
1062022520 9:134326234-134326256 TCGCGGGGCGGCGGCGGCGGAGG + Intronic
1062162469 9:135087829-135087851 GCGCGGGGCGGCGGCGGCGGCGG + Exonic
1062230552 9:135479706-135479728 CTACCGGACGGTGGCGGCGGCGG - Intronic
1062343379 9:136103697-136103719 TCCCAGGGCGGCGGAGGTGGCGG + Intergenic
1062360667 9:136186498-136186520 GTCCCTGGCGGAGGCGGTGGTGG - Intergenic
1062403717 9:136383636-136383658 GTCTCCGGAGGCGGCGGCGGAGG - Exonic
1062560409 9:137139199-137139221 GGGCCCGGCGGCGGCGGCGGCGG - Intronic
1062574562 9:137200215-137200237 GGCGCGGGCGGCGGCGGCGGCGG + Exonic
1202779845 9_KI270717v1_random:24372-24394 AGCCGCGGCGGCGGCGGCGGCGG + Intergenic
1203470679 Un_GL000220v1:114189-114211 GGTCGGGGCGGCGGCGGCGGCGG + Intergenic
1203471019 Un_GL000220v1:115493-115515 TCGGAGGGCGGCGGCGGCGGCGG + Intergenic
1203471457 Un_GL000220v1:116829-116851 TCGGCGCGCGGCGGCGGCGGCGG + Intergenic
1203478500 Un_GL000220v1:158161-158183 GGTCGGGGCGGCGGCGGCGGCGG + Intergenic
1203478840 Un_GL000220v1:159465-159487 TCGGAGGGCGGCGGCGGCGGCGG + Intergenic
1203479278 Un_GL000220v1:160801-160823 TCGGCGCGCGGCGGCGGCGGCGG + Intergenic
1185457756 X:319235-319257 AGCCTCGGCGGCGGCGGCGGCGG + Intergenic
1185457758 X:319238-319260 CTCGGCGGCGGCGGCGGCGGCGG + Intergenic
1185505466 X:630128-630150 TTGGGAGGCGGCGGCGGCGGAGG - Intronic
1186452925 X:9688133-9688155 AGCCAGTGCGGCGGCGGCGGCGG + Exonic
1186829856 X:13379310-13379332 TGCTCGGCCAGCGGCGGCGGCGG - Intergenic
1186917890 X:14243887-14243909 GAACCGGACGGCGGCGGCGGTGG + Intergenic
1187067461 X:15854718-15854740 TTGGCCGGCGGCGGCGGCGGCGG + Exonic
1187226075 X:17376084-17376106 GTCCTCGGCGGCGGCGGCGGCGG + Exonic
1187405570 X:19000810-19000832 AACCCGGGAGGCGGAGGCGGAGG - Intronic
1187507203 X:19887445-19887467 TTCCTCAGTGGCGGCGGCGGCGG + Exonic
1187826190 X:23334804-23334826 GGTTCGGGCGGCGGCGGCGGCGG - Exonic
1188005489 X:25013524-25013546 GTCCCAGGCCGCGGCGGCCGCGG + Exonic
1188542642 X:31266914-31266936 AGCTTGGGCGGCGGCGGCGGCGG - Intronic
1189137120 X:38561514-38561536 TCCGGCGGCGGCGGCGGCGGCGG - Exonic
1189137121 X:38561517-38561539 AGCTCCGGCGGCGGCGGCGGCGG - Exonic
1189323039 X:40097648-40097670 TGCCCGAGCGCGGGCGGCGGCGG - Intronic
1189323075 X:40097813-40097835 TAGGCGGGCGGCGGCGGCGGAGG - Intronic
1189407120 X:40735357-40735379 GTCCCGCCCGGAGGCGGCGGCGG - Exonic
1190119798 X:47650513-47650535 TTCCGAGGCGGCGGTGGAGGTGG + Exonic
1190474401 X:50813131-50813153 AACCCTGGCGGCGGCGGCGGCGG + Intronic
1191129786 X:56995458-56995480 CTTCCTGGTGGCGGCGGCGGTGG + Exonic
1191184095 X:57592085-57592107 CTACAGGGCGGCGGCGGCGGCGG + Exonic
1191213295 X:57910362-57910384 CTACAGGGCGGCGGCGGCGGCGG - Exonic
1191830015 X:65406698-65406720 GGCGCGGGCGGCGGCGGCGGCGG + Intronic
1192166349 X:68829650-68829672 TTCAAGGCCGGCGGCTGCGGAGG + Exonic
1192361751 X:70445109-70445131 GAGCCCGGCGGCGGCGGCGGCGG + Exonic
1192584156 X:72306755-72306777 CTCCGGGGCGGTGGCGGTGGCGG + Intronic
1192925003 X:75747088-75747110 GGCCGCGGCGGCGGCGGCGGTGG - Intergenic
1192988659 X:76427957-76427979 TTGCAACGCGGCGGCGGCGGCGG - Exonic
1194977595 X:100409722-100409744 TCCCGCGGCGGCGGCGGCGGCGG - Exonic
1194977597 X:100409725-100409747 TCCTCCCGCGGCGGCGGCGGCGG - Exonic
1195954797 X:110317833-110317855 CCCCAGGGCTGCGGCGGCGGCGG - Exonic
1196707340 X:118727684-118727706 TGCGCCGGCGGCGGGGGCGGGGG + Exonic
1196828490 X:119758804-119758826 CTCCCGGGAGGCGGCGGCTGCGG - Exonic
1197766156 X:130060575-130060597 GTCCCTGGCGGAGGCGGCCGCGG - Intergenic
1197792304 X:130268484-130268506 TTCGCGGGCCGCGGCAGCTGCGG - Intronic
1198051631 X:132957452-132957474 CTCCACGGCGGCGGCGGCTGCGG + Intronic
1198388141 X:136147718-136147740 GCCCCGAGCGGCGGCGGCGGCGG - Intronic
1198424065 X:136497335-136497357 GATCCGGTCGGCGGCGGCGGCGG + Exonic
1198682217 X:139194956-139194978 CTTCCTGGCGGCGGCAGCGGCGG - Intronic
1198767092 X:140091337-140091359 GACCGAGGCGGCGGCGGCGGCGG + Intergenic
1199500370 X:148500675-148500697 AGCCGGGGCGGCAGCGGCGGCGG - Exonic
1199612733 X:149631765-149631787 TCTCCGGGCGGCGGCGGCGGCGG - Exonic
1199772395 X:150983432-150983454 TGCGGCGGCGGCGGCGGCGGCGG - Intronic
1200000276 X:153056559-153056581 ATGCGCGGCGGCGGCGGCGGCGG - Intronic
1200002590 X:153069698-153069720 TCCCAGGGCGGGGGCGGCCGAGG + Intergenic
1200005134 X:153080312-153080334 TCCCAGGGCGGGGGCGGCCGAGG - Intergenic
1200100729 X:153688229-153688251 GGCTCGGGCGGCGGCGGCTGCGG - Exonic
1200100745 X:153688278-153688300 CGGCCGGGCGGCGGCGGCGGCGG - Exonic
1200128468 X:153829207-153829229 CTCCGGGGCGGGGGCGGGGGCGG - Intronic
1200178701 X:154137040-154137062 TTTCCGGTGAGCGGCGGCGGCGG - Intergenic
1200227808 X:154428782-154428804 GTCGTTGGCGGCGGCGGCGGCGG + Exonic
1200229537 X:154437161-154437183 GTCCAGTGCGGTGGCGGCGGCGG + Exonic
1200229540 X:154437167-154437189 TGCGGTGGCGGCGGCGGCGGTGG + Exonic
1200233652 X:154458283-154458305 TGTGTGGGCGGCGGCGGCGGCGG + Exonic
1200292503 X:154886393-154886415 GGCCTGGGCGGCGGCGGCGCCGG + Exonic
1200339347 X:155382133-155382155 GGCCTGGGCGGCGGCGGCGCCGG + Exonic
1200347123 X:155458560-155458582 GGCCTGGGCGGCGGCGGCGCCGG - Exonic