ID: 1094567785

View in Genome Browser
Species Human (GRCh38)
Location 12:31615994-31616016
Sequence TCAATACCATGTACATGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094567782_1094567785 9 Left 1094567782 12:31615962-31615984 CCTGCTGGACTAATGGTTCACCA No data
Right 1094567785 12:31615994-31616016 TCAATACCATGTACATGAGGTGG No data
1094567781_1094567785 12 Left 1094567781 12:31615959-31615981 CCTCCTGCTGGACTAATGGTTCA No data
Right 1094567785 12:31615994-31616016 TCAATACCATGTACATGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094567785 Original CRISPR TCAATACCATGTACATGAGG TGG Intergenic
No off target data available for this crispr