ID: 1094573649

View in Genome Browser
Species Human (GRCh38)
Location 12:31664034-31664056
Sequence GCATACAAGATAGCAGAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 169}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094573649_1094573652 18 Left 1094573649 12:31664034-31664056 CCTGTTTCTGCTATCTTGTATGC 0: 1
1: 0
2: 0
3: 7
4: 169
Right 1094573652 12:31664075-31664097 TCAGCTAGCCTATGTCCAACGGG 0: 1
1: 0
2: 0
3: 5
4: 59
1094573649_1094573651 17 Left 1094573649 12:31664034-31664056 CCTGTTTCTGCTATCTTGTATGC 0: 1
1: 0
2: 0
3: 7
4: 169
Right 1094573651 12:31664074-31664096 TTCAGCTAGCCTATGTCCAACGG 0: 1
1: 0
2: 2
3: 8
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094573649 Original CRISPR GCATACAAGATAGCAGAAAC AGG (reversed) Intronic
900721307 1:4177568-4177590 GCCCGCAAGATAGCAGAAGCAGG + Intergenic
905476802 1:38234578-38234600 TCATTCAAGAAAACAGAAACTGG - Intergenic
909012220 1:70347501-70347523 GCAAAAAAGGTAGCAGAAATGGG - Intronic
909432681 1:75607731-75607753 GCATGCAAGATAGCATGTACAGG - Intronic
910067881 1:83175092-83175114 ACATATAAGAAAGCAGAAAAAGG + Intergenic
917276879 1:173340641-173340663 ACAAACAAGAAAGCAGACACAGG + Intergenic
919370207 1:196714450-196714472 TCATACAACAGAGCAGAAATTGG - Intronic
921544890 1:216463123-216463145 CCAGACAAGATAGCTGAAACAGG + Intergenic
924074579 1:240320064-240320086 GCATCCAGGTTAGCAGCAACTGG + Intronic
1062856646 10:783202-783224 GCATTCAAGAAAGGAGAAACAGG - Intergenic
1063942011 10:11140428-11140450 GCATACCAGATAGTTGAAATGGG - Intronic
1063987622 10:11522828-11522850 AAATACAAGAAAGCAGCAACAGG + Intronic
1064666276 10:17655368-17655390 ACATAGAAGATAGCAAAAGCAGG - Intronic
1071723434 10:88170475-88170497 GCATCCCAGATAGCAGGAAGAGG - Intergenic
1071894368 10:90049761-90049783 GCTTACAAGCCAGGAGAAACTGG - Intergenic
1072327175 10:94310246-94310268 GCAGAAAAGAAAGCAGAAAGTGG - Intronic
1073716451 10:106113739-106113761 ACATACAAGATCACAGAAAATGG + Intergenic
1074517317 10:114182134-114182156 GAATACAAGATTCCAGACACGGG - Intronic
1079543378 11:21603129-21603151 GCACAGAAGTTAGCAGAAAGAGG + Intergenic
1082635419 11:55587427-55587449 ACCAGCAAGATAGCAGAAACAGG + Intergenic
1082690569 11:56298245-56298267 GAATACATGATAGGAGAAAAAGG - Intergenic
1089799782 11:121016274-121016296 TCATACCAGATATCAGAAGCAGG - Intergenic
1091652915 12:2323117-2323139 GCAAAGAAGAGAGGAGAAACAGG - Intronic
1094573649 12:31664034-31664056 GCATACAAGATAGCAGAAACAGG - Intronic
1094584570 12:31765823-31765845 TCATATAAGATAGCAAAAAAAGG + Intergenic
1098059910 12:66550785-66550807 TGATGCAAGATATCAGAAACAGG + Intronic
1100231859 12:92617172-92617194 GCAGACTAGAAAGCAGAAATGGG - Intergenic
1100450406 12:94700599-94700621 GCATATTATATAGCAGTAACTGG - Intergenic
1101360315 12:104020274-104020296 GCAGAGCAGATGGCAGAAACTGG + Intronic
1102835769 12:116058484-116058506 GCTTACACTATAGCATAAACTGG + Intronic
1103042241 12:117705237-117705259 CCATACTAGAGAGCAGGAACTGG + Intronic
1105450173 13:20492586-20492608 GGAGACATGATGGCAGAAACAGG - Intronic
1106617903 13:31347312-31347334 GCCAGCAAGATAGCAGAAGCAGG + Intergenic
1106645665 13:31631051-31631073 GCCTACAGGTTAGCAGAATCAGG - Intergenic
1107021130 13:35752805-35752827 GCATACCATATGGCAGAAATGGG + Intergenic
1110815630 13:79857396-79857418 GCATATAATGTTGCAGAAACAGG - Intergenic
1111064764 13:83075406-83075428 GCATTCAACATTGCAGCAACAGG + Intergenic
1112603415 13:100879584-100879606 CCATTCACGAGAGCAGAAACTGG - Intergenic
1114848209 14:26349612-26349634 GCATACAAGCAAGCAGAACAAGG + Intergenic
1115922570 14:38392900-38392922 CCATACAAGATACCACAGACTGG + Intergenic
1119689390 14:76659180-76659202 GAATTCAAGAAAGAAGAAACTGG - Intergenic
1124003117 15:25775919-25775941 GTAGACGAGAAAGCAGAAACAGG - Intronic
1128952417 15:71900014-71900036 GAAGACAAAATAACAGAAACTGG + Intronic
1129808448 15:78484676-78484698 GCAGAAAACATAGCAGATACCGG - Intronic
1134358266 16:13505076-13505098 ACAAACAAGAAAGCAGAAAGAGG - Intergenic
1135650020 16:24197760-24197782 GCCTACAAGATGCCAGGAACTGG - Intronic
1137071864 16:35910662-35910684 GTCTACAAGATAGCAGAAGCAGG - Intergenic
1137827112 16:51507973-51507995 GCATTATATATAGCAGAAACCGG + Intergenic
1138879503 16:60993978-60994000 TCATACAAGATAGTTGGAACAGG - Intergenic
1140315267 16:73890319-73890341 GCATACAAAATAGCCAAAAGGGG + Intergenic
1141137770 16:81477865-81477887 GCATTCCAGTTAGCAGAAAGTGG + Intronic
1142176195 16:88646579-88646601 GCACACTAGACAGCAGACACAGG + Intronic
1151241183 17:72759165-72759187 AGATACCAGATAGCAGAAAATGG + Intronic
1154509292 18:15078429-15078451 AAATGCAAGATATCAGAAACAGG - Intergenic
1155574059 18:27225884-27225906 GCCAGCAAGATAGCAGAAGCAGG + Intergenic
1155710131 18:28866804-28866826 CCATAGAAGATAGCTGAATCTGG + Intergenic
1155804185 18:30145267-30145289 GTCAGCAAGATAGCAGAAACAGG + Intergenic
1156604022 18:38644260-38644282 GCAGACAACATAGAAGAAAATGG + Intergenic
1158448805 18:57545179-57545201 GCTCACAAGAAATCAGAAACAGG + Intergenic
1158613460 18:58964272-58964294 CCAAAAAAGATAGGAGAAACTGG - Intronic
1162209118 19:9077608-9077630 GCCAGCAAGATAGCAGAAGCAGG - Intergenic
1163938766 19:20474253-20474275 GCCAGCAAGATAGCAGAAGCAGG - Intergenic
1164494014 19:28741593-28741615 GCATTCACCATAGCAGAGACAGG + Intergenic
1165398762 19:35584059-35584081 GCTTACAACATTCCAGAAACTGG + Intergenic
1166135801 19:40776447-40776469 GCATAAAAAATAGCAGCAGCCGG + Intronic
927159855 2:20246821-20246843 GTATGGAACATAGCAGAAACTGG + Intergenic
929968004 2:46549888-46549910 GCCTACAAGGTAGCAGGCACTGG - Intronic
930174776 2:48290487-48290509 GAATGCAGTATAGCAGAAACAGG - Intergenic
934966025 2:98723305-98723327 GCCAGCAAGATAGCAGAAGCAGG + Intronic
935487017 2:103669903-103669925 GCATAAAAGATATCAGAATCTGG + Intergenic
935734568 2:106096647-106096669 GCCTACAGGACAGCAGACACAGG + Intronic
935868614 2:107419811-107419833 GCATATAAGATAACTGAAACAGG - Intergenic
938488068 2:131735196-131735218 GCTTACACGAAACCAGAAACAGG - Intronic
938809312 2:134837630-134837652 GCTTCCAATATAGCAGAAAGTGG - Intergenic
939880541 2:147625765-147625787 GAATATAATATAGCAGAATCAGG + Intergenic
940413325 2:153391272-153391294 GGAGACAAGGGAGCAGAAACAGG + Intergenic
941703269 2:168628703-168628725 CTATACAAGATGGCAGAAAGTGG + Intronic
947430768 2:230025637-230025659 GCATAAAAGATAGCAGGTATAGG - Intergenic
1171172222 20:23025763-23025785 GCCAGCAAGATAGCAGAAGCAGG - Intergenic
1171944091 20:31360559-31360581 ACTTGCTAGATAGCAGAAACTGG - Intergenic
1176524438 21:7855352-7855374 GCCTTAAAGACAGCAGAAACTGG + Intergenic
1176788781 21:13293381-13293403 AAATGCAAGATATCAGAAACAGG + Intergenic
1177377203 21:20286373-20286395 CCATACAAAGTACCAGAAACTGG - Intergenic
1177987943 21:28001522-28001544 AAATGCAAGATATCAGAAACAGG + Intergenic
1178658458 21:34485365-34485387 GCCTTAAAGACAGCAGAAACTGG + Intergenic
1179769902 21:43606691-43606713 TCATTCAAGATAGCAGGAAATGG + Intronic
1183193859 22:36339756-36339778 CCATACAAGATAGGAGAACACGG + Intronic
949181671 3:1138907-1138929 GTATATCAGATAGCAGAAATCGG - Intronic
950389046 3:12682143-12682165 AGATAGAAGATAGAAGAAACAGG - Intergenic
951018448 3:17755850-17755872 GCATGCAACACAGCAGAAAGAGG + Intronic
954878012 3:53815855-53815877 GCCTGCAAGAGTGCAGAAACAGG - Exonic
955173412 3:56587470-56587492 GCATCTAACATGGCAGAAACAGG + Intronic
957624057 3:82635991-82636013 GCATACAAGAAAGCAAAAGTAGG + Intergenic
961540018 3:127592903-127592925 GCCAGCAAGATAGCAGAAGCAGG - Intronic
961971761 3:130975925-130975947 GCATATAAGTAAGCAGAATCTGG - Intronic
962702852 3:138016212-138016234 GGATAGAAGATGGCAGAAACAGG + Intronic
963322767 3:143827236-143827258 GTATACAAGATACCTGCAACTGG - Intronic
965528390 3:169745952-169745974 GAATACAAGATAGCTGTTACAGG - Intergenic
965612580 3:170560408-170560430 GCAAACAATATGGCAGAAAATGG + Intronic
965871779 3:173274156-173274178 GCCAGCAAGATAGCAGAAGCAGG + Intergenic
965872906 3:173281616-173281638 GCCAGCAAGATAGCAGAAGCAGG + Intergenic
970462407 4:16288162-16288184 GCAAGCAATATGGCAGAAACCGG + Intergenic
970794459 4:19894081-19894103 GCCAGCAAGATAGCAGAAGCAGG + Intergenic
972873522 4:43329718-43329740 CCATACAAAATACCATAAACTGG + Intergenic
973042896 4:45495114-45495136 GCATTAAATATAGCAGACACAGG + Intergenic
973108492 4:46370774-46370796 GAATACAAGCTAGCAGAATAAGG - Intronic
976309952 4:83601389-83601411 GCATAATGGATATCAGAAACTGG - Intronic
976645951 4:87387504-87387526 GCAGTCCAGGTAGCAGAAACTGG - Intronic
977517848 4:98044781-98044803 GCATGAAAGGTAGCAGAAGCTGG + Intronic
977822743 4:101493694-101493716 GCATACAATGCAGAAGAAACTGG - Intronic
978703441 4:111675922-111675944 GCATACAGGCTAGCAGAATGAGG - Intergenic
980121986 4:128737289-128737311 GCCAGCAAGATAGCAGAAGCAGG + Intergenic
981052637 4:140325731-140325753 GCATACTAAATAGCACAACCAGG + Intronic
983331013 4:166329328-166329350 GCTTACAAGATAGAGGAAGCAGG + Intergenic
983475904 4:168211456-168211478 GAATACAAGAAAGGAGAAATAGG + Intergenic
986483168 5:8210018-8210040 TCATACAAGATACCCCAAACGGG + Intergenic
986864577 5:11971287-11971309 CCATACAAAATACCATAAACTGG - Intergenic
987360052 5:17098518-17098540 GCAGACAAGAGAGCAGCAAGGGG - Intronic
991025057 5:62020178-62020200 GCTTCCAAGACAGCAAAAACGGG - Intergenic
992396684 5:76375119-76375141 GCATACCAGATACTAGGAACTGG - Intergenic
995044192 5:107625594-107625616 GCATAACAGCAAGCAGAAACAGG + Intronic
995756069 5:115505650-115505672 GCATATAACATGGCAGAAACAGG + Intergenic
996495147 5:124147240-124147262 CCCTACAAGCTAGAAGAAACTGG - Intergenic
998201770 5:140130515-140130537 GCAGAGAAGAGAGCAGAATCTGG - Intergenic
998287900 5:140882130-140882152 GCAGAAAATATAGCAGAAAGCGG + Intronic
998682268 5:144482147-144482169 GCATAGGAGAGAGGAGAAACAGG - Exonic
1001702298 5:173715815-173715837 TCATTCAAGATAGCAAAACCAGG - Intergenic
1002207574 5:177574207-177574229 GCAGAAAATGTAGCAGAAACAGG - Intergenic
1003305960 6:4929265-4929287 GTATACAAGACAGAAGAAAATGG - Intronic
1003801631 6:9676436-9676458 ACACACAAGATGGCAGAAAATGG - Intronic
1004965457 6:20844552-20844574 GCATATAAAATATCAGTAACAGG + Intronic
1005642902 6:27813993-27814015 GCCTTCAAGATACCACAAACTGG + Intergenic
1008552082 6:52642757-52642779 TAATAAAAGATAACAGAAACAGG - Intergenic
1018183626 6:161245632-161245654 GCATCTCAGATACCAGAAACTGG + Intronic
1020596186 7:10210975-10210997 ACATATTAGATAGCAGAAAGTGG - Intergenic
1022204496 7:28150236-28150258 GCATTCAAGGAAGTAGAAACAGG + Intronic
1022450460 7:30509120-30509142 GCACACAAGATAGTGAAAACTGG + Intronic
1023995190 7:45155557-45155579 GCACACAGGATCGCAGACACAGG + Intergenic
1027276213 7:76559670-76559692 ACATATAAGAAAGCAGAAAAAGG - Intergenic
1027451002 7:78331396-78331418 GCAGTCCAGATAGCAGAATCCGG + Intronic
1027684123 7:81260275-81260297 GCATGCAAGCTAGAAGAAAGTGG - Intergenic
1028220750 7:88194188-88194210 GCAGACAATTTAGCAGAAAGTGG - Intronic
1028270085 7:88777540-88777562 TAATATAAGATTGCAGAAACTGG + Intronic
1028622408 7:92838730-92838752 ACATAAAAGATAGCAGTATCAGG - Intergenic
1030138360 7:106281050-106281072 ACATACTAGATAACAGTAACTGG + Intronic
1031011515 7:116528712-116528734 ACAAACAAAATAACAGAAACAGG + Intronic
1033685050 7:143631576-143631598 GGATACAAGATACTAGAAAGAGG - Intronic
1033688223 7:143710795-143710817 GGATACAAGATACTAGAAAGAGG - Intronic
1033699563 7:143826045-143826067 GGATACAAGATACTAGAAAGAGG + Intergenic
1037268312 8:17094201-17094223 ACATACAACATAGATGAAACTGG - Intronic
1037779270 8:21856515-21856537 GCAGCCATGATTGCAGAAACAGG + Intergenic
1038842602 8:31199554-31199576 CCATAAAAGACAGCAGAAAGTGG - Intergenic
1041129206 8:54679319-54679341 AAATACAAGATAGCAGGAAAGGG - Intergenic
1043063192 8:75530753-75530775 GCATACAAGACAGAAGACAGTGG + Intronic
1043768731 8:84169818-84169840 TCAGGCAAGATAGCAGAAGCAGG - Intergenic
1043856732 8:85273573-85273595 TCAGGCAAGATAGCAGAAGCAGG + Intronic
1046208230 8:111032512-111032534 GGATAGCAGATGGCAGAAACCGG + Intergenic
1046730064 8:117715108-117715130 GCAAACAAGATGGTAGAAAGTGG - Intergenic
1047074119 8:121380509-121380531 GGATCCAAGATGGCAGAAAGAGG + Intergenic
1047222108 8:122927000-122927022 GCATATAAGATAGCATTCACAGG + Intronic
1050793588 9:9507274-9507296 ACACACAAAATTGCAGAAACTGG + Intronic
1053671159 9:40363740-40363762 TCATACAAAATACCACAAACTGG + Intergenic
1053920970 9:42990120-42990142 TCATACAAAATACCACAAACTGG + Intergenic
1054382276 9:64503814-64503836 TCATACAAAATACCACAAACTGG + Intergenic
1054513455 9:66012560-66012582 TCATACAAAATACCACAAACTGG - Intergenic
1054784064 9:69193610-69193632 GCATACAAGATAGAATAATGAGG + Intronic
1055113113 9:72579040-72579062 GTAGACAAGATAGCATAAAGAGG - Intronic
1058186464 9:101861112-101861134 GAGTACAACATAGCAGAAAGAGG + Intergenic
1058286843 9:103189233-103189255 GCCAGCAAGATAGCAGAAGCAGG - Intergenic
1059700238 9:116768840-116768862 CCATACAAAATATCATAAACTGG - Intronic
1187558214 X:20373382-20373404 GGATGCAAGAGAGCAGAAAAAGG - Intergenic
1194005865 X:88491167-88491189 GTATACAAAATATCACAAACTGG + Intergenic
1196194444 X:112825071-112825093 GCCTAAAAGAAAGCAGAAATAGG - Intronic
1199215987 X:145260908-145260930 GTAGACAAGATTGAAGAAACAGG - Intergenic
1200742957 Y:6874698-6874720 GCATGAAAGAAAGCAGAAATGGG - Intergenic
1201688610 Y:16736433-16736455 CCATACAAGCTAGAAGAAAGTGG - Intergenic
1202591035 Y:26483427-26483449 AAATACCAGATAACAGAAACTGG - Intergenic