ID: 1094578918

View in Genome Browser
Species Human (GRCh38)
Location 12:31715177-31715199
Sequence ATGTTGTTTTAGGAGCTAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 1, 2: 1, 3: 22, 4: 232}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094578918 Original CRISPR ATGTTGTTTTAGGAGCTAAA GGG (reversed) Intronic
901712770 1:11128674-11128696 ATTTTCTTTTAGAAACTAAAGGG - Intronic
903409174 1:23126212-23126234 AAGTTGCTTTAGGAGGTAGAAGG - Intronic
903792107 1:25900846-25900868 ATGTTGTTTTAGGGGCTAAAGGG - Intronic
904709803 1:32421562-32421584 CTGATATTGTAGGAGCTAAAGGG - Intergenic
907679328 1:56549030-56549052 CTATTGTTTTAGGAACTAGACGG - Intronic
907935678 1:59040112-59040134 ATTTTGTTATAGTAGCCAAATGG - Intergenic
910771206 1:90834568-90834590 ATGTTGATTTAGTTGCTAATTGG - Intergenic
910864146 1:91772341-91772363 ATTTTTGTTTAGGATCTAAAGGG + Intronic
911246775 1:95526475-95526497 ATTTTGTTATAGGAGCTCAAAGG + Intergenic
911784537 1:101929539-101929561 ATGCTGTCTCAGGAGCTAATTGG - Intronic
912581595 1:110725864-110725886 ATGTTGTTCTAGGTGCTGCAAGG - Intergenic
913973289 1:143433193-143433215 ATTTTGTTTTAGCGGCTCAAAGG + Intergenic
913991886 1:143620627-143620649 ATGTTGTTTTGGCAGCAATAAGG - Intergenic
914067675 1:144258800-144258822 ATTTTGTTTTAGCGGCTCAAAGG + Intergenic
914111480 1:144707554-144707576 ATTTTGTTTTAGCGGCTCAAAGG - Intergenic
916449040 1:164902159-164902181 TTGTTTTTCTAGGAGCTCAAAGG - Intergenic
918521676 1:185421489-185421511 AATTTGTTTTAGGATCTTAAAGG - Intergenic
918654256 1:187004017-187004039 AAATTTTTTTAGGAGCTCAATGG + Intergenic
922277761 1:224095032-224095054 TTGTTCTTTTATGAGCTCAAAGG + Intergenic
922972590 1:229755427-229755449 AGGTGGTCTTAGGAGCCAAAAGG + Intergenic
923341921 1:233014983-233015005 AAGTTATTTTAGGAGAGAAAAGG + Intronic
1064731994 10:18340941-18340963 ATTTAGTTTGAGGAGCTATAAGG - Intronic
1067331528 10:45326230-45326252 ATGTTGTTTTTGGAGGGGAATGG - Intergenic
1067550511 10:47231508-47231530 ATTCTGTTTTAGTTGCTAAATGG + Intergenic
1068718900 10:60220196-60220218 ATTTTTTTTTATGAACTAAAAGG + Intronic
1069248623 10:66241885-66241907 ATTTTGTTTTAGGAGTGGAATGG - Intronic
1070031160 10:72678750-72678772 ATGTTATTCTAGAATCTAAAAGG + Intergenic
1070451951 10:76567896-76567918 AAGTTGCTTTAATAGCTAAATGG - Intergenic
1071673068 10:87629404-87629426 ATGTTATTACAGCAGCTAAAAGG + Intergenic
1071961788 10:90814340-90814362 CTGTGGTTATAGGGGCTAAAGGG + Intronic
1072320117 10:94241439-94241461 TTGTTGTTTTAAGAGCAAAAAGG - Intronic
1073743273 10:106436376-106436398 AGGTAGTTTTAAGAACTAAAAGG - Intergenic
1074610096 10:115013707-115013729 ATTTTGTTATAGCAGCTGAATGG - Intergenic
1080765038 11:35288211-35288233 AGGTTGTTTTAGGAGCTCGTGGG - Intronic
1081895161 11:46579576-46579598 ATGTTGTATTAAGAGAGAAAAGG - Intronic
1085852262 11:80135819-80135841 ATGTTGGTATAGAAGATAAAAGG - Intergenic
1086150266 11:83601436-83601458 AAGTTGTTTGAGAAGCTAACAGG - Intronic
1086811171 11:91311998-91312020 ATATTGTTTTAGCAGCTATGTGG + Intergenic
1087229337 11:95642137-95642159 CTGTTGATTTTGTAGCTAAAAGG + Intergenic
1087982389 11:104632000-104632022 ATAATGTTTTAGCAGCTATATGG - Intergenic
1088164476 11:106916972-106916994 ATGTTGTTCTAGGAGCTAACTGG + Intronic
1088683553 11:112265874-112265896 ATGTTGATTTATGAGCTAATTGG + Intronic
1089255140 11:117190158-117190180 ATGTTGTTGAAGGCGCTAGAAGG - Exonic
1089813250 11:121148668-121148690 ATGGTGCTTTAGGAGCAAAGGGG + Intronic
1090816675 11:130303187-130303209 AAGTTGTTTCAGAAGCTAGAGGG + Intronic
1094437634 12:30438865-30438887 CTTTTATTTTAGCAGCTAAAAGG - Intergenic
1094578918 12:31715177-31715199 ATGTTGTTTTAGGAGCTAAAGGG - Intronic
1096727949 12:53580238-53580260 ATTTTGTTTTATTAGATAAAAGG - Intronic
1097008743 12:55937670-55937692 AGGCTGGTCTAGGAGCTAAAGGG + Intronic
1098017867 12:66125536-66125558 TAGATATTTTAGGAGCTAAAGGG - Intronic
1098692554 12:73506628-73506650 AATTTGTTATAGGAGCCAAATGG - Intergenic
1101035719 12:100703913-100703935 ATGTTGGTTTATCAGCTTAATGG + Intergenic
1102105392 12:110317235-110317257 CTGTTGTTTTTGAATCTAAATGG - Intronic
1103603850 12:122072153-122072175 AGGGTGATTTAGGAGCAAAAGGG - Intergenic
1104723973 12:131064786-131064808 ATGTTGTTTTAGAAAGCAAAGGG + Intronic
1105848029 13:24309658-24309680 GCGTTGTTTTAGGACCTAGATGG - Intronic
1108534199 13:51356604-51356626 ATGTACTTTTAGGACATAAAAGG - Intronic
1108679527 13:52767553-52767575 ATTTTGTTTTAGCAGCTCAAAGG + Intergenic
1109828346 13:67753504-67753526 ATGTTGTTTTTATAGCTAGATGG + Intergenic
1112638011 13:101239004-101239026 ATGTTTTTTAAGGAGGGAAATGG - Intronic
1113145838 13:107206249-107206271 ATTCTGTCTTAGGAGATAAAAGG - Intronic
1115692011 14:35854195-35854217 ATGTTCTTTAAGAAGCAAAAAGG - Intronic
1117794059 14:59373638-59373660 ATATTGTTTATGGAACTAAATGG - Intergenic
1119059067 14:71456010-71456032 ATTTTGTTTTTACAGCTAAAGGG + Intronic
1119955240 14:78791140-78791162 ATGTTGTTTTAGGTGTGATAAGG - Intronic
1120456268 14:84734493-84734515 AAGTTGTTTTAAAACCTAAATGG + Intergenic
1120823489 14:88934353-88934375 ATGCTTTTCTTGGAGCTAAAGGG - Intergenic
1121977033 14:98414588-98414610 ATTTTGCTTTTGGAACTAAATGG - Intergenic
1122697141 14:103561704-103561726 AAGATGTGTGAGGAGCTAAAAGG - Intronic
1123913265 15:24992148-24992170 ATGTGGATTTAGGAGATAAGAGG + Intergenic
1131588922 15:93727389-93727411 ATGTCAATTTAGGAGATAAATGG - Intergenic
1132012622 15:98289381-98289403 ATGCAGGTTTTGGAGCTAAATGG + Intergenic
1133676258 16:8075749-8075771 ATGTTGTCTTAGGGGTGAAAGGG - Intergenic
1135069305 16:19338292-19338314 ATGTTGTTGAAGGGGCAAAATGG + Intergenic
1135097663 16:19577960-19577982 ATTTTGTTATAGCAGCTCAAAGG + Intronic
1137394724 16:48108855-48108877 AGGTTTATTTGGGAGCTAAAGGG + Intronic
1137895918 16:52212245-52212267 ATGTGGTTTTAAGATCCAAAAGG + Intergenic
1142379696 16:89724254-89724276 ATGTTGTTTTAGGAGGGCCAGGG + Intronic
1144513904 17:15901719-15901741 ATTGTGTTTTAGGAGCCAGAGGG - Intergenic
1145959246 17:28877209-28877231 TTGTTGTTTTAGTAGCGACAGGG + Intergenic
1155402792 18:25457452-25457474 ATGTTGTGTTCTGAGATAAAAGG + Intergenic
1155585019 18:27354939-27354961 ATGTTGTAGTAGGAACTAGAGGG + Intergenic
1157792871 18:50548575-50548597 ATGTTGTTTTGGTAGGAAAAGGG + Intergenic
1159306547 18:66650612-66650634 ATTTTGTTATAGCAGCTGAATGG + Intergenic
1159617299 18:70596322-70596344 ATGTTGCTTTTGGAGTCAAAGGG + Intergenic
1159752437 18:72319257-72319279 GTGTTGCTTGAGGAGATAAAAGG - Intergenic
1159791997 18:72793073-72793095 ATATTGGTTTAAGAACTAAACGG + Intronic
1163951672 19:20593699-20593721 ATGTTCTTTTATTAGCAAAAAGG + Intronic
925756722 2:7140115-7140137 ATGGTGTTTTTGGAGCTTCATGG - Intergenic
926934531 2:18073723-18073745 ATAGTGTTTTAGGAAATAAATGG + Intronic
927258311 2:21060071-21060093 AGGTTGTTTTAGCAGCTACTAGG - Intergenic
927523714 2:23719003-23719025 ATGTTGTTTTATGTGGTAAAGGG - Intergenic
928637768 2:33265861-33265883 AATGTGTTATAGGAGCTAAATGG + Intronic
930504489 2:52264887-52264909 AGATTGTTTTAGGAGCTCAATGG + Intergenic
930506721 2:52291692-52291714 ATTATTTTTTAGGAGCTCAATGG - Intergenic
932012015 2:67988210-67988232 ATTTTGTTATAGCACCTAAATGG - Intergenic
933106216 2:78328801-78328823 AAGTAGTTTTAGAAGTTAAAAGG - Intergenic
934177984 2:89594160-89594182 ATTTTGTTTTAGCGGCTCAAAGG + Intergenic
934288282 2:91668451-91668473 ATTTTGTTTTAGCGGCTCAAAGG + Intergenic
935614178 2:105059634-105059656 AGGTTGGTTTAGGAGTGAAAAGG + Intronic
935729218 2:106051220-106051242 AAGTTGTATTGGGAGCCAAAAGG - Intergenic
936722619 2:115271081-115271103 ATATTGTTTTTGCAGCTTAAAGG + Intronic
937788686 2:125933449-125933471 ATATAGTTTTAGCAGTTAAATGG + Intergenic
939143725 2:138387845-138387867 ATGAAGTTTGAGGGGCTAAAGGG - Intergenic
939556774 2:143684686-143684708 ATGTTGTTTTGCAAGCTAACCGG + Intronic
939813320 2:146863670-146863692 TTGTTTTTTTAGTAACTAAATGG + Intergenic
940112324 2:150168445-150168467 ATTTTGTTATAGTAGCCAAAAGG + Intergenic
941054737 2:160774425-160774447 ATTTTGTTTTAGGAGCACAAAGG - Intergenic
941136940 2:161729251-161729273 ATGTTGTTTGTGGATATAAATGG - Intronic
943531710 2:189090351-189090373 ATGTTGGTTTATGAGGTTAAAGG + Intronic
944991307 2:205239247-205239269 AAGGTGTTCTAGGTGCTAAAAGG + Intronic
945868945 2:215206111-215206133 ATTTTTTTTAAGGAGCTCAATGG + Intergenic
946461770 2:219875310-219875332 GAGGTGTTTTAGGTGCTAAAAGG + Intergenic
946823766 2:223655848-223655870 ATTTTGTTGTAGCAGCTGAATGG + Intergenic
1168879553 20:1194896-1194918 ATTTTGTTATAGCAGCAAAAAGG - Intergenic
1169991773 20:11512683-11512705 ATGTTGGTTTAGAACTTAAAAGG - Intergenic
1170298090 20:14851579-14851601 ATACTGTCTTAGGAGCTACAGGG + Intronic
1173002358 20:39113589-39113611 TTTTTGTTTTAGTATCTAAAAGG + Intergenic
1174806632 20:53608998-53609020 AAGTTGTTAAAGGAGCCAAAGGG - Intronic
1179171697 21:38977874-38977896 ATGTTCTTTTAAGGGCTAAAGGG - Intergenic
949146938 3:712542-712564 ATGTTGTTTAAGGATCAAATAGG - Intergenic
949432219 3:3989853-3989875 AAGTTGTTATAGGAGCCCAAAGG - Intronic
953138222 3:40202284-40202306 AGGTTGTTTCAGGAGGCAAAGGG - Intronic
953830421 3:46293377-46293399 ATGTTGTTGTAGGGGGTAGAGGG - Intergenic
957419777 3:79952121-79952143 TTGTTGTTATAGGATTTAAACGG - Intergenic
961603828 3:128079119-128079141 ATGCTGTTTAAGGAGCAAGATGG - Intronic
962869708 3:139477339-139477361 ATGTTGTTTTAAGATCCAAGGGG + Intronic
964604764 3:158548810-158548832 CTGTTGCATTAGGAACTAAATGG + Intergenic
965587194 3:170329324-170329346 ATTTTTTCTTAGCAGCTAAAGGG + Intergenic
966126706 3:176586071-176586093 ATGGGGTTTTTGAAGCTAAAAGG - Intergenic
966571123 3:181444713-181444735 ATGTTGTTTAAGTGGCCAAAAGG - Intergenic
966645722 3:182244638-182244660 ATGTTGATTTGGGCGCTACAGGG - Intergenic
969831264 4:9799231-9799253 ATTTTGTTTTAGCAGCTCAAAGG - Intronic
971083832 4:23246979-23247001 ATTTTGTTATAGCAGCAAAATGG + Intergenic
972421309 4:38889864-38889886 ATGTTGGTTTAGTAGCTCAGCGG + Intronic
972853740 4:43081304-43081326 ATGTTTTTTAAGGAGCTCAATGG - Intergenic
973720496 4:53719004-53719026 ATTTTGTTATAGCAGCCAAATGG + Intronic
974539307 4:63212832-63212854 ATGTTGCTTTAACAGCAAAATGG + Intergenic
975064460 4:70043088-70043110 CTGTTGTTTTCGTAGATAAATGG - Intergenic
975915798 4:79324285-79324307 ATTTTATTAGAGGAGCTAAATGG - Intronic
976480567 4:85539457-85539479 ATGTTGTTTGAAGAAATAAATGG + Intronic
977382129 4:96288892-96288914 ATGTTGTTTAATAAGCTATATGG + Intergenic
977503365 4:97869529-97869551 ATGCAGTTATAGGAGATAAATGG + Intronic
978081447 4:104597880-104597902 ATTTTGTTATAGCAGCTGAAGGG - Intergenic
979226560 4:118292501-118292523 ATGTAGTTATAGGAGCTGAGAGG - Intronic
979774079 4:124565767-124565789 TTGATGTTTTAGGATGTAAAAGG - Intergenic
979937302 4:126714108-126714130 ATGTAGTTTTGGGAAATAAAAGG - Intergenic
980014374 4:127631803-127631825 ATGTTATTTTATGATCTAAAAGG - Intronic
980033038 4:127852551-127852573 CTATTGATATAGGAGCTAAAAGG + Intergenic
980407690 4:132374606-132374628 ATATTGTTTTAGAAATTAAATGG + Intergenic
980774916 4:137425269-137425291 ATGTTGGTTTAGGGGATAAAGGG - Intergenic
981687791 4:147474445-147474467 ATTTTGTTATAGCAGCCAAATGG - Intergenic
982956105 4:161768669-161768691 ATGTTTTTTTCAGAGCTCAAAGG + Intronic
983793914 4:171836004-171836026 ATGTAGTATTTGGAGCTGAAGGG + Intronic
984040285 4:174724815-174724837 ATATTTTTTTAGGTGCTGAAAGG - Intronic
986406071 5:7426286-7426308 ATTTTGTTATAGCAGCAAAATGG - Intronic
986427482 5:7649171-7649193 TTGTGGTTCTAGGAGATAAAGGG - Intronic
987298560 5:16576260-16576282 ATCTTGTTTTTGAAGATAAATGG - Intronic
987647990 5:20700889-20700911 ATGTTTTATTGGGAGCTAAGTGG + Intergenic
988104002 5:26719328-26719350 ATTTTGTTATCGCAGCTAAATGG + Intergenic
988748346 5:34167979-34168001 ATGTTTTATTGGGAGCTAAGTGG - Intergenic
989214359 5:38888526-38888548 ATAGTGTTATAGGAGTTAAAAGG - Intronic
989585623 5:43072083-43072105 ATGATATTTTAGAAGATAAATGG + Intronic
989659397 5:43783292-43783314 ATAAGGTTTTAGGAGATAAAGGG - Intergenic
991159828 5:63485146-63485168 ATGTTTCTTTAGCAGCAAAAAGG + Intergenic
992838432 5:80663297-80663319 AGGTTGTTTTAGCAGCTATCAGG + Intronic
993019585 5:82575735-82575757 ATATTGTTTTTGGAGGCAAAGGG - Intergenic
995794969 5:115931372-115931394 GTGTTGTTTTATATGCTAAAAGG - Intergenic
996460894 5:123741770-123741792 ATCTTTTTTTAGGAGATAGACGG + Intergenic
996551746 5:124737772-124737794 ATGTTATTTTGAGAGCTCAAAGG - Intronic
998364039 5:141617472-141617494 ATGTTGTTTTATGACCTAGAGGG - Intronic
998965570 5:147536737-147536759 TTGTTGTTTTAAAACCTAAATGG - Intergenic
999350959 5:150871290-150871312 ATTTTGTTTTAAGAGCTCAATGG + Intronic
1000448553 5:161356032-161356054 ATGTGGTTTTAGGAAATAAAAGG + Intronic
1003545521 6:7055183-7055205 ATGTTCTTTTAAGAGTCAAAGGG + Intergenic
1004213649 6:13680433-13680455 ATGTTTTTTTATGAGCTCCATGG - Intronic
1004395910 6:15246199-15246221 ATGTAGTTTTTGGAGGAAAAAGG + Intergenic
1005545915 6:26871093-26871115 ATGTTTTATTGGGAGCTAAGTGG - Intergenic
1006234544 6:32617173-32617195 ATTTTGTTATAGCAGCTGAATGG - Intergenic
1008069376 6:47084206-47084228 ATTTTGTTATAGCAGCTGAATGG - Intergenic
1008386605 6:50898179-50898201 CTGCTGTTCTAGGAGCTGAAAGG + Intergenic
1008580282 6:52900563-52900585 AAGTTGTTTTAAGAAATAAAAGG - Intronic
1009016628 6:57911874-57911896 ATGTTTTATTGGGAGCTAAGTGG - Intergenic
1010178912 6:73062023-73062045 ATTTTATTTTAAGAGGTAAATGG + Intronic
1010922488 6:81701293-81701315 ATGTTTATTTAGCAGCTAAAAGG + Intronic
1012313366 6:97755704-97755726 ATATTCTTTTAAGGGCTAAAGGG + Intergenic
1012343836 6:98162152-98162174 ATGTTCTTTTAGCAGTTAATTGG - Intergenic
1013949542 6:115763252-115763274 ATGTTGTTTTACATGCCAAAAGG - Intergenic
1015307522 6:131726351-131726373 AGGTTGTTATAGGTGCTACACGG + Intronic
1016002810 6:139059528-139059550 ATGTTTTTTTTGTAGCCAAAAGG - Intergenic
1017657095 6:156640329-156640351 CTGTTGTTTTAGAAAATAAATGG - Intergenic
1018910606 6:168099154-168099176 TTGTTGTTTTAGAAGCAATAGGG - Intergenic
1019070017 6:169337797-169337819 ATATTTTTTTAGGAGCTCAATGG - Intergenic
1019957042 7:4423891-4423913 GTGTTGTTAGAGGAGGTAAAGGG - Intergenic
1020415907 7:7945521-7945543 ATGTTGTTTTGGGACTTAATTGG + Intronic
1025910710 7:65826235-65826257 ATGATGGTGAAGGAGCTAAAAGG + Intergenic
1028447202 7:90939036-90939058 ATTTTGTTAAAGGAGCAAAAAGG - Intronic
1029503995 7:100951166-100951188 ATTTTGTTTTAGTAGAGAAAGGG + Intronic
1030062075 7:105630378-105630400 TTATTGGTTTAGGAGTTAAATGG - Intronic
1030271808 7:107676675-107676697 ACATTGTTTTAGAAGCTAATAGG - Intronic
1030771390 7:113479291-113479313 AATTTGTATTAGTAGCTAAAGGG + Intergenic
1030926195 7:115458019-115458041 ATGTAGTTTTAAGTGCTAGAAGG + Intergenic
1032100755 7:128974924-128974946 CTGCTGTTCTAGGAGCTGAAAGG + Exonic
1034217035 7:149415679-149415701 ATTTTGCTTTAGGAAATAAATGG - Intergenic
1036829665 8:12012016-12012038 AGGATGTTTTAGAAGGTAAATGG - Intergenic
1036910314 8:12753725-12753747 AGGTGGTTTTAGGCGCTGAAAGG - Intronic
1037486360 8:19351108-19351130 CTGTTATTTTAGAAGCAAAAAGG + Intronic
1038178195 8:25200875-25200897 TGGTTGTTTAAGGATCTAAATGG + Intronic
1038482044 8:27908626-27908648 ATGTTGTATTAGGAGGGAAAAGG - Intronic
1040417307 8:47206751-47206773 ATGTTGTTTTTGGCCCCAAAGGG + Intergenic
1041802669 8:61816525-61816547 GTGTGGTTTTAGGACATAAAAGG + Intergenic
1041917204 8:63149638-63149660 ATGCTGTTTTATGGGCTGAAAGG - Intergenic
1042403331 8:68374591-68374613 TTAATGTTTTAGGAGCTATATGG - Intronic
1042482374 8:69318565-69318587 ATGTAATTTTAGGAGCAACAGGG - Intergenic
1042654260 8:71078558-71078580 ATTTTTTTTTAGCAGCTTAATGG + Intergenic
1043639037 8:82425890-82425912 ATGTTTTTTCAGTAGGTAAAGGG - Intergenic
1044336675 8:90992147-90992169 ATGTTATTTTAGAAGAAAAAAGG - Intergenic
1044937100 8:97303670-97303692 AGGTCGTTTTATGGGCTAAATGG - Intergenic
1045837847 8:106544424-106544446 ATCTTGCTTTAGAAGCTAAAAGG + Intronic
1046385616 8:113505846-113505868 ATATTTTTTTAGGAGTTCAATGG - Intergenic
1046594356 8:116243359-116243381 GTATTGTTTTAGGTGCCAAATGG - Intergenic
1048698355 8:137055038-137055060 AAGTTGTTTTAGGTGATCAAAGG + Intergenic
1051559635 9:18425912-18425934 ATGTTCTTTTGGAAGGTAAAGGG + Intergenic
1055079810 9:72258005-72258027 ATGTTGTTTAATGAAATAAATGG + Intergenic
1056091367 9:83208757-83208779 AAGTTGTTCTGGGAGCTTAAAGG + Intergenic
1057255952 9:93547220-93547242 ATGTTCTTGTAGGAGCAATATGG + Intronic
1057348004 9:94269054-94269076 TTTTTTTTTTAGGAGCTCAATGG - Intronic
1058065984 9:100548677-100548699 ATGTTTTTATCTGAGCTAAAGGG + Intronic
1058864484 9:109149029-109149051 AATTTGTTTTAGGAAGTAAAGGG + Intronic
1061536363 9:131252605-131252627 ATGTTCTTTTAGGAGTGACAAGG - Intergenic
1186044948 X:5525692-5525714 ATAGTGTTTTAGGAGCTATCGGG + Intergenic
1186216030 X:7302248-7302270 AGGTTGTTGTATGAGCAAAAGGG + Intronic
1186269688 X:7873306-7873328 ATGTTGCTTCAGGAGGTAGATGG - Intergenic
1186748598 X:12597241-12597263 ATGTGATTGTAGGATCTAAAAGG - Intronic
1187618948 X:21029400-21029422 ATTTTGTTATAGTAGCCAAATGG - Intergenic
1188124715 X:26352902-26352924 ATGTTGTTTTAAGAGATTACGGG - Intergenic
1188159785 X:26785049-26785071 ATATTGATATAGGAGTTAAAAGG - Intergenic
1188546850 X:31317303-31317325 ATGTTGTCTTAGCTGCTAAAAGG + Intronic
1191787477 X:64932659-64932681 ATTTTGTTTCAGGAGGTGAAAGG + Intronic
1192765597 X:74136895-74136917 CTGATATTGTAGGAGCTAAAGGG - Intergenic
1193402424 X:81061500-81061522 ATGTTTATGTAGGAGATAAATGG - Intergenic
1193881096 X:86921852-86921874 ATGTAGTTTAAGTAGCTAGAAGG + Intergenic
1194288943 X:92045168-92045190 ATGATGTTTTAGAAGCTCAGGGG + Intronic
1194721912 X:97350358-97350380 ACAGTGTTTTAGGATCTAAATGG - Intronic
1194847404 X:98827329-98827351 ATGTTGTCTTACAAGCTCAAGGG - Intergenic
1194913885 X:99681106-99681128 ATGTTGTCTAAGGAACTTAATGG - Intergenic
1195638705 X:107149859-107149881 CTGTTGTCTTAGCAGCTAAATGG - Intronic
1196324708 X:114389515-114389537 CTGCTGTTCTAGGAGCTGAAAGG - Intergenic
1196848403 X:119915054-119915076 ATGTTGTTCTAGAAGCCAAATGG - Intronic
1196925228 X:120627734-120627756 ATTTAGTTTTAGGAACAAAAGGG - Intronic
1197795419 X:130292830-130292852 GTTTTGTTTTGGGAGTTAAAGGG - Intergenic
1198143742 X:133833119-133833141 ATGTTTTTTCAGGAGGGAAATGG + Intronic
1200273267 X:154708261-154708283 ATTTTCTTCTAGGGGCTAAATGG - Intronic
1201791647 Y:17847810-17847832 ATGTTTTTCTAGCAGCAAAATGG - Intergenic
1201809907 Y:18058179-18058201 ATGTTTTTCTAGCAGCAAAATGG + Intergenic
1202353256 Y:24017462-24017484 ATGTTTTTCTAGCAGCAAAATGG - Intergenic
1202517523 Y:25652653-25652675 ATGTTTTTCTAGCAGCAAAATGG + Intergenic