ID: 1094586761

View in Genome Browser
Species Human (GRCh38)
Location 12:31784175-31784197
Sequence ATCATTGGTGGCCATCTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094586761_1094586771 24 Left 1094586761 12:31784175-31784197 CCTCCAAGATGGCCACCAATGAT No data
Right 1094586771 12:31784222-31784244 TTTGTCAGCCCCTCCCACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094586761 Original CRISPR ATCATTGGTGGCCATCTTGG AGG (reversed) Intergenic