ID: 1094586762

View in Genome Browser
Species Human (GRCh38)
Location 12:31784178-31784200
Sequence AGGATCATTGGTGGCCATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094586762_1094586771 21 Left 1094586762 12:31784178-31784200 CCAAGATGGCCACCAATGATCCT No data
Right 1094586771 12:31784222-31784244 TTTGTCAGCCCCTCCCACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094586762 Original CRISPR AGGATCATTGGTGGCCATCT TGG (reversed) Intergenic