ID: 1094586766

View in Genome Browser
Species Human (GRCh38)
Location 12:31784198-31784220
Sequence GGGCATGACTACCAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094586766_1094586777 24 Left 1094586766 12:31784198-31784220 CCTTCCTCCTGGTAGTCATGCCC No data
Right 1094586777 12:31784245-31784267 TCTGAGTGACTAATTGAATGTGG No data
1094586766_1094586771 1 Left 1094586766 12:31784198-31784220 CCTTCCTCCTGGTAGTCATGCCC No data
Right 1094586771 12:31784222-31784244 TTTGTCAGCCCCTCCCACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094586766 Original CRISPR GGGCATGACTACCAGGAGGA AGG (reversed) Intergenic