ID: 1094586767

View in Genome Browser
Species Human (GRCh38)
Location 12:31784202-31784224
Sequence AAAAGGGCATGACTACCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094586767_1094586771 -3 Left 1094586767 12:31784202-31784224 CCTCCTGGTAGTCATGCCCTTTT No data
Right 1094586771 12:31784222-31784244 TTTGTCAGCCCCTCCCACAATGG No data
1094586767_1094586778 29 Left 1094586767 12:31784202-31784224 CCTCCTGGTAGTCATGCCCTTTT No data
Right 1094586778 12:31784254-31784276 CTAATTGAATGTGGCAGAAATGG No data
1094586767_1094586777 20 Left 1094586767 12:31784202-31784224 CCTCCTGGTAGTCATGCCCTTTT No data
Right 1094586777 12:31784245-31784267 TCTGAGTGACTAATTGAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094586767 Original CRISPR AAAAGGGCATGACTACCAGG AGG (reversed) Intergenic