ID: 1094586768

View in Genome Browser
Species Human (GRCh38)
Location 12:31784205-31784227
Sequence GACAAAAGGGCATGACTACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094586768_1094586777 17 Left 1094586768 12:31784205-31784227 CCTGGTAGTCATGCCCTTTTGTC No data
Right 1094586777 12:31784245-31784267 TCTGAGTGACTAATTGAATGTGG No data
1094586768_1094586771 -6 Left 1094586768 12:31784205-31784227 CCTGGTAGTCATGCCCTTTTGTC No data
Right 1094586771 12:31784222-31784244 TTTGTCAGCCCCTCCCACAATGG No data
1094586768_1094586778 26 Left 1094586768 12:31784205-31784227 CCTGGTAGTCATGCCCTTTTGTC No data
Right 1094586778 12:31784254-31784276 CTAATTGAATGTGGCAGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094586768 Original CRISPR GACAAAAGGGCATGACTACC AGG (reversed) Intergenic