ID: 1094586771

View in Genome Browser
Species Human (GRCh38)
Location 12:31784222-31784244
Sequence TTTGTCAGCCCCTCCCACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094586762_1094586771 21 Left 1094586762 12:31784178-31784200 CCAAGATGGCCACCAATGATCCT No data
Right 1094586771 12:31784222-31784244 TTTGTCAGCCCCTCCCACAATGG No data
1094586767_1094586771 -3 Left 1094586767 12:31784202-31784224 CCTCCTGGTAGTCATGCCCTTTT No data
Right 1094586771 12:31784222-31784244 TTTGTCAGCCCCTCCCACAATGG No data
1094586765_1094586771 9 Left 1094586765 12:31784190-31784212 CCAATGATCCTTCCTCCTGGTAG No data
Right 1094586771 12:31784222-31784244 TTTGTCAGCCCCTCCCACAATGG No data
1094586768_1094586771 -6 Left 1094586768 12:31784205-31784227 CCTGGTAGTCATGCCCTTTTGTC No data
Right 1094586771 12:31784222-31784244 TTTGTCAGCCCCTCCCACAATGG No data
1094586766_1094586771 1 Left 1094586766 12:31784198-31784220 CCTTCCTCCTGGTAGTCATGCCC No data
Right 1094586771 12:31784222-31784244 TTTGTCAGCCCCTCCCACAATGG No data
1094586763_1094586771 12 Left 1094586763 12:31784187-31784209 CCACCAATGATCCTTCCTCCTGG No data
Right 1094586771 12:31784222-31784244 TTTGTCAGCCCCTCCCACAATGG No data
1094586761_1094586771 24 Left 1094586761 12:31784175-31784197 CCTCCAAGATGGCCACCAATGAT No data
Right 1094586771 12:31784222-31784244 TTTGTCAGCCCCTCCCACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094586771 Original CRISPR TTTGTCAGCCCCTCCCACAA TGG Intergenic