ID: 1094592940

View in Genome Browser
Species Human (GRCh38)
Location 12:31838226-31838248
Sequence CACATGAGGGTTCGTGGACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094592940_1094592948 4 Left 1094592940 12:31838226-31838248 CCTGGTCCACGAACCCTCATGTG No data
Right 1094592948 12:31838253-31838275 AAAAGGCCAGGGTCTCTCTGAGG No data
1094592940_1094592946 -8 Left 1094592940 12:31838226-31838248 CCTGGTCCACGAACCCTCATGTG No data
Right 1094592946 12:31838241-31838263 CTCATGTGGCAGAAAAGGCCAGG No data
1094592940_1094592950 18 Left 1094592940 12:31838226-31838248 CCTGGTCCACGAACCCTCATGTG No data
Right 1094592950 12:31838267-31838289 TCTCTGAGGCCTCTTTCATAAGG No data
1094592940_1094592947 -7 Left 1094592940 12:31838226-31838248 CCTGGTCCACGAACCCTCATGTG No data
Right 1094592947 12:31838242-31838264 TCATGTGGCAGAAAAGGCCAGGG No data
1094592940_1094592951 19 Left 1094592940 12:31838226-31838248 CCTGGTCCACGAACCCTCATGTG No data
Right 1094592951 12:31838268-31838290 CTCTGAGGCCTCTTTCATAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094592940 Original CRISPR CACATGAGGGTTCGTGGACC AGG (reversed) Intergenic
No off target data available for this crispr