ID: 1094592947

View in Genome Browser
Species Human (GRCh38)
Location 12:31838242-31838264
Sequence TCATGTGGCAGAAAAGGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094592933_1094592947 24 Left 1094592933 12:31838195-31838217 CCAGCAGATTCTGTCTGGTGAGG 0: 2
1: 5
2: 8
3: 38
4: 238
Right 1094592947 12:31838242-31838264 TCATGTGGCAGAAAAGGCCAGGG No data
1094592939_1094592947 -6 Left 1094592939 12:31838225-31838247 CCCTGGTCCACGAACCCTCATGT No data
Right 1094592947 12:31838242-31838264 TCATGTGGCAGAAAAGGCCAGGG No data
1094592938_1094592947 -1 Left 1094592938 12:31838220-31838242 CCACTCCCTGGTCCACGAACCCT No data
Right 1094592947 12:31838242-31838264 TCATGTGGCAGAAAAGGCCAGGG No data
1094592940_1094592947 -7 Left 1094592940 12:31838226-31838248 CCTGGTCCACGAACCCTCATGTG No data
Right 1094592947 12:31838242-31838264 TCATGTGGCAGAAAAGGCCAGGG No data
1094592937_1094592947 0 Left 1094592937 12:31838219-31838241 CCCACTCCCTGGTCCACGAACCC No data
Right 1094592947 12:31838242-31838264 TCATGTGGCAGAAAAGGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094592947 Original CRISPR TCATGTGGCAGAAAAGGCCA GGG Intergenic
No off target data available for this crispr