ID: 1094592950

View in Genome Browser
Species Human (GRCh38)
Location 12:31838267-31838289
Sequence TCTCTGAGGCCTCTTTCATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094592944_1094592950 5 Left 1094592944 12:31838239-31838261 CCCTCATGTGGCAGAAAAGGCCA No data
Right 1094592950 12:31838267-31838289 TCTCTGAGGCCTCTTTCATAAGG No data
1094592940_1094592950 18 Left 1094592940 12:31838226-31838248 CCTGGTCCACGAACCCTCATGTG No data
Right 1094592950 12:31838267-31838289 TCTCTGAGGCCTCTTTCATAAGG No data
1094592945_1094592950 4 Left 1094592945 12:31838240-31838262 CCTCATGTGGCAGAAAAGGCCAG No data
Right 1094592950 12:31838267-31838289 TCTCTGAGGCCTCTTTCATAAGG No data
1094592937_1094592950 25 Left 1094592937 12:31838219-31838241 CCCACTCCCTGGTCCACGAACCC No data
Right 1094592950 12:31838267-31838289 TCTCTGAGGCCTCTTTCATAAGG No data
1094592942_1094592950 12 Left 1094592942 12:31838232-31838254 CCACGAACCCTCATGTGGCAGAA No data
Right 1094592950 12:31838267-31838289 TCTCTGAGGCCTCTTTCATAAGG No data
1094592938_1094592950 24 Left 1094592938 12:31838220-31838242 CCACTCCCTGGTCCACGAACCCT No data
Right 1094592950 12:31838267-31838289 TCTCTGAGGCCTCTTTCATAAGG No data
1094592939_1094592950 19 Left 1094592939 12:31838225-31838247 CCCTGGTCCACGAACCCTCATGT No data
Right 1094592950 12:31838267-31838289 TCTCTGAGGCCTCTTTCATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094592950 Original CRISPR TCTCTGAGGCCTCTTTCATA AGG Intergenic
No off target data available for this crispr