ID: 1094595541

View in Genome Browser
Species Human (GRCh38)
Location 12:31862852-31862874
Sequence CCGGAGTCCTTGGGATATAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094595541_1094595546 25 Left 1094595541 12:31862852-31862874 CCTGTATATCCCAAGGACTCCGG No data
Right 1094595546 12:31862900-31862922 AATCAATAAAAGTAGTGATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094595541 Original CRISPR CCGGAGTCCTTGGGATATAC AGG (reversed) Intergenic
No off target data available for this crispr