ID: 1094608944

View in Genome Browser
Species Human (GRCh38)
Location 12:31974558-31974580
Sequence TAGTATCCCCCATAGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 58}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094608944 Original CRISPR TAGTATCCCCCATAGGAAGA GGG (reversed) Intronic
901423120 1:9164069-9164091 TGGGATCCCCCAGAGGAGGAAGG + Intergenic
911786183 1:101950781-101950803 TAGTATCCTCTATAAGAACAAGG + Intronic
921511461 1:216035839-216035861 TAATATCTCACATAGGAATAAGG - Intronic
921985190 1:221305276-221305298 AAGTATCCCCCAAAGGCAGCTGG + Intergenic
1066549835 10:36544351-36544373 AATTATGCCCCAAAGGAAGAAGG - Intergenic
1069392728 10:67953096-67953118 AAAGATCACCCATAGGAAGAGGG + Intronic
1072619320 10:97069091-97069113 CAGCATCCCACTTAGGAAGATGG - Intronic
1079982972 11:27171136-27171158 TAGTAGCCCCCAAAGTAAGAAGG + Intergenic
1080184946 11:29471905-29471927 TAGTATTCCCCTTAGGAAGATGG + Intergenic
1085943452 11:81235847-81235869 GAGTAGCCCCCATAGAAGGATGG - Intergenic
1088929947 11:114341377-114341399 TAGTTCCTCCCAAAGGAAGAAGG + Intergenic
1094241135 12:28226058-28226080 TAGTATCTCACATAACAAGAAGG - Intronic
1094608944 12:31974558-31974580 TAGTATCCCCCATAGGAAGAGGG - Intronic
1095485060 12:42676195-42676217 TAGTATCTCCCTTAGTAATAGGG + Intergenic
1096045678 12:48560133-48560155 TTGTCTCCCCCTTAGAAAGAAGG - Intergenic
1107967969 13:45614535-45614557 GAGTTTCCCCCATAGCAGGAGGG - Intronic
1119644596 14:76339305-76339327 TAGTATCCCCGTTATGGAGATGG - Intronic
1125794180 15:42392318-42392340 TAGTATCCTTCAAAGGAGGAAGG - Intronic
1130916197 15:88307055-88307077 TAATCTCCCCCAGAGGAAGCTGG + Intergenic
1132007238 15:98239141-98239163 AAGTTTCCTCCACAGGAAGAAGG - Intergenic
1147603626 17:41761177-41761199 TAGCATCTCCCATAGGGAGTTGG - Intronic
1150195239 17:63291076-63291098 TAGTATTTCCTATAGGAAGCTGG - Intronic
1151875493 17:76865825-76865847 GAGTATCCCCCTTAGGAAGAGGG + Intergenic
1151994520 17:77600314-77600336 TATTGTCCCCCATTGGCAGACGG - Intergenic
1156148680 18:34218346-34218368 TAGTAGCCACAATAGGGAGATGG - Intronic
1157958223 18:52123070-52123092 TTGTATGCCCCATAGTAATAAGG - Intergenic
1163712168 19:18853349-18853371 TAGTATCCTTCATGTGAAGAGGG + Exonic
928918033 2:36494827-36494849 TAATGTCCTCCAAAGGAAGAAGG - Intronic
931866032 2:66412811-66412833 AACTATGCCCCATAGGTAGAGGG - Intergenic
935106182 2:100045697-100045719 CAGTATACTCCACAGGAAGATGG + Intronic
942044304 2:172090541-172090563 TAGTTTCCTCCAGAGGAACACGG + Intergenic
946956639 2:224937641-224937663 CTCTATCCCCCATAGGAAAAAGG + Intronic
947274648 2:228376545-228376567 ATGTTTCCCCCATATGAAGAGGG - Intergenic
1177474682 21:21604350-21604372 TACTATCCCCGATGGGCAGATGG - Intergenic
1178213174 21:30561117-30561139 CAGTATCCCCCATAGCATGATGG + Exonic
1178219112 21:30635420-30635442 CAGTATCTTCCATAGCAAGATGG - Exonic
1182601823 22:31471126-31471148 TAGTTTCCCTCAGAAGAAGAAGG - Intronic
1183942391 22:41302714-41302736 TATTTTCCCCCCTGGGAAGACGG - Intronic
956519176 3:70084841-70084863 TAGTATCCCCAATTTGCAGATGG + Intergenic
964705848 3:159617708-159617730 TACTACCCCCCCTAGGAAGAGGG + Intronic
967091473 3:186138242-186138264 TATTTTCCCCCTTAGGAAGTTGG + Intronic
970291577 4:14578653-14578675 TAGGATACCCCATAAGAAGGAGG - Intergenic
971277621 4:25213051-25213073 TATTATCTCACATAGGAGGAAGG - Intronic
971616235 4:28793671-28793693 TAGTTACATCCATAGGAAGAAGG - Intergenic
975405435 4:73982967-73982989 TAGAATCCCACATAGGAAAGGGG + Intergenic
976219125 4:82741926-82741948 TAAAATCCCCCAAAGAAAGATGG + Intronic
986937838 5:12913240-12913262 TAGTATCCTCCATAGTTAGAAGG + Intergenic
1007841640 6:44720860-44720882 TAGTTTCCCCCTCTGGAAGATGG + Intergenic
1011501302 6:87993017-87993039 AAGTGTCTCCCTTAGGAAGATGG - Intergenic
1011905287 6:92358418-92358440 TTGTATACCACATAGTAAGAGGG - Intergenic
1012624740 6:101392508-101392530 CAGTTTCCCCCAGAGGAAGTTGG - Intergenic
1023336892 7:39179888-39179910 TATTATCCCCATTTGGAAGATGG - Intronic
1024179491 7:46876497-46876519 TAGTATCCTCCATTGGAAAATGG - Intergenic
1033818570 7:145106090-145106112 TGATCTCCCCCATGGGAAGAAGG - Intergenic
1040924756 8:52667706-52667728 TACTACCCCCCATAGGACGAAGG - Intronic
1043350094 8:79349996-79350018 TTGGGTCCCCCATAGGAAGTGGG + Intergenic
1044774668 8:95675812-95675834 TAGTAAACACCATTGGAAGAAGG + Intergenic
1047989777 8:130273927-130273949 CAGCATCCTCCATAGGATGAAGG + Intronic
1049277370 8:141726505-141726527 GGGGATCCCCCAGAGGAAGAAGG + Intergenic
1056657586 9:88522076-88522098 AAGTCACCCCCAAAGGAAGAAGG + Intergenic
1188443802 X:30236050-30236072 TAGTAGCCCCCAAAATAAGAGGG - Exonic
1189556177 X:42147745-42147767 TAGTATCCCCCCTAGCAGGATGG - Intergenic
1190430069 X:50370401-50370423 AAGTCTCCCCCACAGGCAGAGGG - Intronic
1190751490 X:53365892-53365914 TAGTAAACCCAATAGGAAAATGG - Intergenic
1190808788 X:53864109-53864131 TAGAGTCCCTCACAGGAAGATGG - Intergenic
1193701923 X:84773340-84773362 TAATATACCCCAGATGAAGAAGG - Intergenic
1196898756 X:120362706-120362728 TAGAATCCCCAATAGGAGCAGGG + Intronic
1199792603 X:151169295-151169317 CAGTATCCGCCAGAGGCAGATGG + Intergenic