ID: 1094616464

View in Genome Browser
Species Human (GRCh38)
Location 12:32040773-32040795
Sequence CAGGGAAGGACACATACTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094616458_1094616464 11 Left 1094616458 12:32040739-32040761 CCTGGAGAACTATGCTAAATGAA No data
Right 1094616464 12:32040773-32040795 CAGGGAAGGACACATACTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094616464 Original CRISPR CAGGGAAGGACACATACTGC AGG Intergenic
No off target data available for this crispr