ID: 1094617566

View in Genome Browser
Species Human (GRCh38)
Location 12:32049568-32049590
Sequence TCTCTGGGCCCCCAGCAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094617566_1094617572 26 Left 1094617566 12:32049568-32049590 CCAACTTGCTGGGGGCCCAGAGA No data
Right 1094617572 12:32049617-32049639 TCCATCTGTCTGCCAGAGCTGGG No data
1094617566_1094617569 -6 Left 1094617566 12:32049568-32049590 CCAACTTGCTGGGGGCCCAGAGA No data
Right 1094617569 12:32049585-32049607 CAGAGAGAACAAGAACAGAAAGG No data
1094617566_1094617570 -5 Left 1094617566 12:32049568-32049590 CCAACTTGCTGGGGGCCCAGAGA No data
Right 1094617570 12:32049586-32049608 AGAGAGAACAAGAACAGAAAGGG No data
1094617566_1094617571 25 Left 1094617566 12:32049568-32049590 CCAACTTGCTGGGGGCCCAGAGA No data
Right 1094617571 12:32049616-32049638 GTCCATCTGTCTGCCAGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094617566 Original CRISPR TCTCTGGGCCCCCAGCAAGT TGG (reversed) Intergenic
No off target data available for this crispr