ID: 1094617567

View in Genome Browser
Species Human (GRCh38)
Location 12:32049583-32049605
Sequence TTTCTGTTCTTGTTCTCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094617567_1094617572 11 Left 1094617567 12:32049583-32049605 CCCAGAGAGAACAAGAACAGAAA No data
Right 1094617572 12:32049617-32049639 TCCATCTGTCTGCCAGAGCTGGG No data
1094617567_1094617571 10 Left 1094617567 12:32049583-32049605 CCCAGAGAGAACAAGAACAGAAA No data
Right 1094617571 12:32049616-32049638 GTCCATCTGTCTGCCAGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094617567 Original CRISPR TTTCTGTTCTTGTTCTCTCT GGG (reversed) Intergenic
No off target data available for this crispr